ID: 1026909651

View in Genome Browser
Species Human (GRCh38)
Location 7:74084407-74084429
Sequence GGCTGGGGAAGCCGCAGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026909637_1026909651 27 Left 1026909637 7:74084357-74084379 CCCGGGCCTCGCCCTGGGGCCAC 0: 1
1: 2
2: 2
3: 55
4: 478
Right 1026909651 7:74084407-74084429 GGCTGGGGAAGCCGCAGCCCCGG No data
1026909647_1026909651 -3 Left 1026909647 7:74084387-74084409 CCAGTCTCGGAAGAAAGAGCGGC 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1026909651 7:74084407-74084429 GGCTGGGGAAGCCGCAGCCCCGG No data
1026909639_1026909651 21 Left 1026909639 7:74084363-74084385 CCTCGCCCTGGGGCCACCCTTTA 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1026909651 7:74084407-74084429 GGCTGGGGAAGCCGCAGCCCCGG No data
1026909641_1026909651 15 Left 1026909641 7:74084369-74084391 CCTGGGGCCACCCTTTATCCAGT 0: 1
1: 0
2: 2
3: 12
4: 117
Right 1026909651 7:74084407-74084429 GGCTGGGGAAGCCGCAGCCCCGG No data
1026909643_1026909651 8 Left 1026909643 7:74084376-74084398 CCACCCTTTATCCAGTCTCGGAA 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1026909651 7:74084407-74084429 GGCTGGGGAAGCCGCAGCCCCGG No data
1026909645_1026909651 4 Left 1026909645 7:74084380-74084402 CCTTTATCCAGTCTCGGAAGAAA 0: 1
1: 0
2: 0
3: 18
4: 142
Right 1026909651 7:74084407-74084429 GGCTGGGGAAGCCGCAGCCCCGG No data
1026909636_1026909651 30 Left 1026909636 7:74084354-74084376 CCACCCGGGCCTCGCCCTGGGGC 0: 1
1: 0
2: 4
3: 50
4: 478
Right 1026909651 7:74084407-74084429 GGCTGGGGAAGCCGCAGCCCCGG No data
1026909640_1026909651 16 Left 1026909640 7:74084368-74084390 CCCTGGGGCCACCCTTTATCCAG 0: 1
1: 0
2: 2
3: 12
4: 161
Right 1026909651 7:74084407-74084429 GGCTGGGGAAGCCGCAGCCCCGG No data
1026909644_1026909651 5 Left 1026909644 7:74084379-74084401 CCCTTTATCCAGTCTCGGAAGAA 0: 1
1: 0
2: 0
3: 11
4: 91
Right 1026909651 7:74084407-74084429 GGCTGGGGAAGCCGCAGCCCCGG No data
1026909638_1026909651 26 Left 1026909638 7:74084358-74084380 CCGGGCCTCGCCCTGGGGCCACC 0: 1
1: 1
2: 9
3: 65
4: 504
Right 1026909651 7:74084407-74084429 GGCTGGGGAAGCCGCAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026909651 Original CRISPR GGCTGGGGAAGCCGCAGCCC CGG Intronic
No off target data available for this crispr