ID: 1026911751

View in Genome Browser
Species Human (GRCh38)
Location 7:74095158-74095180
Sequence GATGAGATGAGGGACCTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 218}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026911751_1026911761 19 Left 1026911751 7:74095158-74095180 CCCTTAAGGTCCCTCATCTCATC 0: 1
1: 0
2: 1
3: 15
4: 218
Right 1026911761 7:74095200-74095222 CCTGCCTCTCTCCTAGATTGTGG 0: 1
1: 0
2: 12
3: 114
4: 495
1026911751_1026911763 27 Left 1026911751 7:74095158-74095180 CCCTTAAGGTCCCTCATCTCATC 0: 1
1: 0
2: 1
3: 15
4: 218
Right 1026911763 7:74095208-74095230 TCTCCTAGATTGTGGCCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026911751 Original CRISPR GATGAGATGAGGGACCTTAA GGG (reversed) Intronic