ID: 1026911752

View in Genome Browser
Species Human (GRCh38)
Location 7:74095159-74095181
Sequence GGATGAGATGAGGGACCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026911752_1026911761 18 Left 1026911752 7:74095159-74095181 CCTTAAGGTCCCTCATCTCATCC No data
Right 1026911761 7:74095200-74095222 CCTGCCTCTCTCCTAGATTGTGG 0: 1
1: 0
2: 12
3: 114
4: 495
1026911752_1026911763 26 Left 1026911752 7:74095159-74095181 CCTTAAGGTCCCTCATCTCATCC No data
Right 1026911763 7:74095208-74095230 TCTCCTAGATTGTGGCCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026911752 Original CRISPR GGATGAGATGAGGGACCTTA AGG (reversed) Intronic