ID: 1026911754

View in Genome Browser
Species Human (GRCh38)
Location 7:74095168-74095190
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 337}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026911754_1026911765 24 Left 1026911754 7:74095168-74095190 CCCTCATCTCATCCAGGTCCCAG 0: 1
1: 0
2: 2
3: 41
4: 337
Right 1026911765 7:74095215-74095237 GATTGTGGCCCTTTGGAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 109
1026911754_1026911763 17 Left 1026911754 7:74095168-74095190 CCCTCATCTCATCCAGGTCCCAG 0: 1
1: 0
2: 2
3: 41
4: 337
Right 1026911763 7:74095208-74095230 TCTCCTAGATTGTGGCCCTTTGG No data
1026911754_1026911761 9 Left 1026911754 7:74095168-74095190 CCCTCATCTCATCCAGGTCCCAG 0: 1
1: 0
2: 2
3: 41
4: 337
Right 1026911761 7:74095200-74095222 CCTGCCTCTCTCCTAGATTGTGG 0: 1
1: 0
2: 12
3: 114
4: 495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026911754 Original CRISPR CTGGGACCTGGATGAGATGA GGG (reversed) Intronic