ID: 1026911756

View in Genome Browser
Species Human (GRCh38)
Location 7:74095180-74095202
Sequence AGGTAGGAAAGACTGGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026911756_1026911761 -3 Left 1026911756 7:74095180-74095202 CCAGGTCCCAGTCTTTCCTACCT No data
Right 1026911761 7:74095200-74095222 CCTGCCTCTCTCCTAGATTGTGG 0: 1
1: 0
2: 12
3: 114
4: 495
1026911756_1026911763 5 Left 1026911756 7:74095180-74095202 CCAGGTCCCAGTCTTTCCTACCT No data
Right 1026911763 7:74095208-74095230 TCTCCTAGATTGTGGCCCTTTGG No data
1026911756_1026911765 12 Left 1026911756 7:74095180-74095202 CCAGGTCCCAGTCTTTCCTACCT No data
Right 1026911765 7:74095215-74095237 GATTGTGGCCCTTTGGAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026911756 Original CRISPR AGGTAGGAAAGACTGGGACC TGG (reversed) Intronic