ID: 1026911757

View in Genome Browser
Species Human (GRCh38)
Location 7:74095186-74095208
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 435}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026911757_1026911765 6 Left 1026911757 7:74095186-74095208 CCCAGTCTTTCCTACCTGCCTCT 0: 1
1: 0
2: 2
3: 49
4: 435
Right 1026911765 7:74095215-74095237 GATTGTGGCCCTTTGGAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 109
1026911757_1026911761 -9 Left 1026911757 7:74095186-74095208 CCCAGTCTTTCCTACCTGCCTCT 0: 1
1: 0
2: 2
3: 49
4: 435
Right 1026911761 7:74095200-74095222 CCTGCCTCTCTCCTAGATTGTGG 0: 1
1: 0
2: 12
3: 114
4: 495
1026911757_1026911763 -1 Left 1026911757 7:74095186-74095208 CCCAGTCTTTCCTACCTGCCTCT 0: 1
1: 0
2: 2
3: 49
4: 435
Right 1026911763 7:74095208-74095230 TCTCCTAGATTGTGGCCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026911757 Original CRISPR AGAGGCAGGTAGGAAAGACT GGG (reversed) Intronic