ID: 1026911758

View in Genome Browser
Species Human (GRCh38)
Location 7:74095187-74095209
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1279
Summary {0: 1, 1: 0, 2: 3, 3: 131, 4: 1144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026911758_1026911765 5 Left 1026911758 7:74095187-74095209 CCAGTCTTTCCTACCTGCCTCTC 0: 1
1: 0
2: 3
3: 131
4: 1144
Right 1026911765 7:74095215-74095237 GATTGTGGCCCTTTGGAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 109
1026911758_1026911763 -2 Left 1026911758 7:74095187-74095209 CCAGTCTTTCCTACCTGCCTCTC 0: 1
1: 0
2: 3
3: 131
4: 1144
Right 1026911763 7:74095208-74095230 TCTCCTAGATTGTGGCCCTTTGG No data
1026911758_1026911761 -10 Left 1026911758 7:74095187-74095209 CCAGTCTTTCCTACCTGCCTCTC 0: 1
1: 0
2: 3
3: 131
4: 1144
Right 1026911761 7:74095200-74095222 CCTGCCTCTCTCCTAGATTGTGG 0: 1
1: 0
2: 12
3: 114
4: 495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026911758 Original CRISPR GAGAGGCAGGTAGGAAAGAC TGG (reversed) Intronic