ID: 1026911763

View in Genome Browser
Species Human (GRCh38)
Location 7:74095208-74095230
Sequence TCTCCTAGATTGTGGCCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026911752_1026911763 26 Left 1026911752 7:74095159-74095181 CCTTAAGGTCCCTCATCTCATCC No data
Right 1026911763 7:74095208-74095230 TCTCCTAGATTGTGGCCCTTTGG No data
1026911758_1026911763 -2 Left 1026911758 7:74095187-74095209 CCAGTCTTTCCTACCTGCCTCTC 0: 1
1: 0
2: 3
3: 131
4: 1144
Right 1026911763 7:74095208-74095230 TCTCCTAGATTGTGGCCCTTTGG No data
1026911757_1026911763 -1 Left 1026911757 7:74095186-74095208 CCCAGTCTTTCCTACCTGCCTCT 0: 1
1: 0
2: 2
3: 49
4: 435
Right 1026911763 7:74095208-74095230 TCTCCTAGATTGTGGCCCTTTGG No data
1026911751_1026911763 27 Left 1026911751 7:74095158-74095180 CCCTTAAGGTCCCTCATCTCATC 0: 1
1: 0
2: 1
3: 15
4: 218
Right 1026911763 7:74095208-74095230 TCTCCTAGATTGTGGCCCTTTGG No data
1026911755_1026911763 16 Left 1026911755 7:74095169-74095191 CCTCATCTCATCCAGGTCCCAGT No data
Right 1026911763 7:74095208-74095230 TCTCCTAGATTGTGGCCCTTTGG No data
1026911754_1026911763 17 Left 1026911754 7:74095168-74095190 CCCTCATCTCATCCAGGTCCCAG 0: 1
1: 0
2: 2
3: 41
4: 337
Right 1026911763 7:74095208-74095230 TCTCCTAGATTGTGGCCCTTTGG No data
1026911756_1026911763 5 Left 1026911756 7:74095180-74095202 CCAGGTCCCAGTCTTTCCTACCT No data
Right 1026911763 7:74095208-74095230 TCTCCTAGATTGTGGCCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026911763 Original CRISPR TCTCCTAGATTGTGGCCCTT TGG Intronic