ID: 1026911765

View in Genome Browser
Species Human (GRCh38)
Location 7:74095215-74095237
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026911754_1026911765 24 Left 1026911754 7:74095168-74095190 CCCTCATCTCATCCAGGTCCCAG 0: 1
1: 0
2: 2
3: 41
4: 337
Right 1026911765 7:74095215-74095237 GATTGTGGCCCTTTGGAGCCTGG No data
1026911756_1026911765 12 Left 1026911756 7:74095180-74095202 CCAGGTCCCAGTCTTTCCTACCT No data
Right 1026911765 7:74095215-74095237 GATTGTGGCCCTTTGGAGCCTGG No data
1026911760_1026911765 -8 Left 1026911760 7:74095200-74095222 CCTGCCTCTCTCCTAGATTGTGG 0: 1
1: 0
2: 11
3: 42
4: 255
Right 1026911765 7:74095215-74095237 GATTGTGGCCCTTTGGAGCCTGG No data
1026911758_1026911765 5 Left 1026911758 7:74095187-74095209 CCAGTCTTTCCTACCTGCCTCTC 0: 1
1: 0
2: 3
3: 131
4: 1144
Right 1026911765 7:74095215-74095237 GATTGTGGCCCTTTGGAGCCTGG No data
1026911755_1026911765 23 Left 1026911755 7:74095169-74095191 CCTCATCTCATCCAGGTCCCAGT No data
Right 1026911765 7:74095215-74095237 GATTGTGGCCCTTTGGAGCCTGG No data
1026911759_1026911765 -4 Left 1026911759 7:74095196-74095218 CCTACCTGCCTCTCTCCTAGATT No data
Right 1026911765 7:74095215-74095237 GATTGTGGCCCTTTGGAGCCTGG No data
1026911757_1026911765 6 Left 1026911757 7:74095186-74095208 CCCAGTCTTTCCTACCTGCCTCT 0: 1
1: 0
2: 2
3: 49
4: 435
Right 1026911765 7:74095215-74095237 GATTGTGGCCCTTTGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type