ID: 1026912636

View in Genome Browser
Species Human (GRCh38)
Location 7:74100225-74100247
Sequence AAACCCTGTCTCAAAAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2747
Summary {0: 2, 1: 22, 2: 272, 3: 904, 4: 1547}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026912636 Original CRISPR AAACCCTGTCTCAAAAAAAT GGG Intronic