ID: 1026912830

View in Genome Browser
Species Human (GRCh38)
Location 7:74101567-74101589
Sequence GCATTCGCCCAGCCAACATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026912826_1026912830 2 Left 1026912826 7:74101542-74101564 CCTCCCTGTCTGCCTCACTGGGT 0: 1
1: 1
2: 5
3: 40
4: 673
Right 1026912830 7:74101567-74101589 GCATTCGCCCAGCCAACATCTGG No data
1026912827_1026912830 -1 Left 1026912827 7:74101545-74101567 CCCTGTCTGCCTCACTGGGTAAG 0: 1
1: 0
2: 1
3: 18
4: 200
Right 1026912830 7:74101567-74101589 GCATTCGCCCAGCCAACATCTGG No data
1026912828_1026912830 -2 Left 1026912828 7:74101546-74101568 CCTGTCTGCCTCACTGGGTAAGC 0: 1
1: 0
2: 0
3: 13
4: 123
Right 1026912830 7:74101567-74101589 GCATTCGCCCAGCCAACATCTGG No data
1026912829_1026912830 -10 Left 1026912829 7:74101554-74101576 CCTCACTGGGTAAGCATTCGCCC 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1026912830 7:74101567-74101589 GCATTCGCCCAGCCAACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026912830 Original CRISPR GCATTCGCCCAGCCAACATC TGG Intronic
No off target data available for this crispr