ID: 1026913435

View in Genome Browser
Species Human (GRCh38)
Location 7:74106072-74106094
Sequence CTGAATCAGCAGGTCAATCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026913435 Original CRISPR CTGAATCAGCAGGTCAATCT GGG (reversed) Exonic
905012018 1:34754318-34754340 CTGTATCAGCAGGTCACTTGGGG - Intronic
905713795 1:40130771-40130793 TTGAATCTGCAGATCAATTTGGG + Intergenic
906971157 1:50515470-50515492 CTGATTCAGTAGGTCTAGCTTGG + Intronic
907070363 1:51529077-51529099 CTGAATCAGTAGATCAATTTGGG - Intergenic
907239145 1:53071056-53071078 CTGAATTAGGAGGTTACTCTGGG - Intronic
907302115 1:53494355-53494377 CTGAATCTGTAGATCAAACTGGG + Intergenic
908012693 1:59797333-59797355 CTGAATCTGTAGATCAATTTGGG + Intergenic
908046713 1:60178383-60178405 CTGAATCAACAGGTAAATAAGGG - Intergenic
909887013 1:80954525-80954547 CTGAATCTACAGATCAATTTGGG - Intergenic
909961892 1:81856119-81856141 CTGAAGCAGCAGGTGCTTCTGGG + Intronic
912784574 1:112587881-112587903 CTGAATCCGTAGATCAATTTAGG + Intronic
913365445 1:118032992-118033014 CTGATTCAGTAGGTCAAGGTGGG - Intronic
916686557 1:167152447-167152469 CTGTATAAGCATGTCAACCTGGG - Intergenic
917727124 1:177838784-177838806 GTGAATCAGCAGGGCAAGCCTGG + Intergenic
918464562 1:184808098-184808120 CTGAACCACCAGATCAATGTGGG + Exonic
920746010 1:208629294-208629316 CTGAACCAGCTGATCAGTCTTGG + Intergenic
921701857 1:218277806-218277828 TTGAATCTGTAGGTCAATTTGGG + Intergenic
923476391 1:234335507-234335529 TTGAATAAACATGTCAATCTTGG - Intergenic
1065416602 10:25495036-25495058 CTGAAGCTGCAGGTCAATGGTGG + Intronic
1065758215 10:28954847-28954869 TTGAATCTGTAGATCAATCTGGG - Intergenic
1066142104 10:32515152-32515174 TTGAATCTGCAGGACAATTTGGG - Intronic
1066424470 10:35293530-35293552 CTGAATCTGTAGGTCAACTTGGG + Intronic
1066554210 10:36593375-36593397 ATGAATAAGCAGGTCGATCAAGG - Intergenic
1067086880 10:43246334-43246356 TTGAATCTGTAGGTCAATTTGGG - Intronic
1071036638 10:81255312-81255334 CTGAATCTGTAGATCAATTTGGG + Intergenic
1072601863 10:96938933-96938955 CTGAATCAGCGTATCAATTTGGG - Intronic
1073480285 10:103782264-103782286 CTGATTCAGCAGGTCCGCCTGGG - Intronic
1074390400 10:113052713-113052735 ATGAATCCGCAGTTCAAGCTTGG - Intronic
1074629670 10:115238318-115238340 CTGAATCTGCATATCAAGCTGGG + Intronic
1074993612 10:118735455-118735477 CTGATTCAGCAGGTCTGTGTTGG - Intronic
1076352612 10:129828253-129828275 CTGAATCTGTAGATCAATTTTGG + Intergenic
1080273537 11:30476814-30476836 CTGAATCTACAGATCAATTTAGG + Intronic
1084314072 11:68333848-68333870 CTGAATCCACTGATCAATCTGGG - Intronic
1084347280 11:68562367-68562389 TTGAATCTGCAGGTCCATTTGGG - Intronic
1085612688 11:77966845-77966867 CTGAATCTGCAGATCATTTTGGG + Intronic
1086602222 11:88647450-88647472 CAGAATCAGCAAGTGAATCATGG - Intronic
1086621937 11:88897067-88897089 ATGAATCATCAGTTCAATCATGG + Intronic
1086849184 11:91788945-91788967 ATGAGTCAGCAGGTCCTTCTGGG - Intergenic
1087193608 11:95282693-95282715 CTGCATCAGCAGTTGAGTCTGGG - Intergenic
1088322585 11:108568915-108568937 CTGAATGACCAGGTCAAATTAGG - Intronic
1089445888 11:118551822-118551844 CTGCATCAGCGTGTCAATGTCGG + Exonic
1090244245 11:125204346-125204368 CTGATTCAGCAGGTCTGTGTGGG + Intronic
1091706056 12:2694157-2694179 GTGGATCAGAAGGTCAAGCTAGG - Intronic
1096589635 12:52649040-52649062 CTGGTTCAGCAGGTCCACCTTGG + Exonic
1096784324 12:54008588-54008610 CTGAGCCAGCAGGTCAACCCAGG - Intronic
1097957281 12:65499191-65499213 CTGAATTAACAGGTTAATTTGGG - Intergenic
1097996324 12:65891657-65891679 CTGATTCTGCAGCTCAAACTTGG - Intronic
1099964113 12:89426973-89426995 CTGAATCTGCATATCAATGTGGG - Intronic
1100947660 12:99804896-99804918 ATGATTCAGCAGGTCAGCCTGGG - Intronic
1104766474 12:131333379-131333401 CAGGATCAGCAGGTCATCCTAGG + Intergenic
1104812938 12:131629245-131629267 CGGGATCAGCAGGTCACCCTAGG - Intergenic
1105503672 13:20992350-20992372 CGGCATCAGCAGGTCAGGCTGGG + Intronic
1105641863 13:22273757-22273779 CTGCATCTTCAGGTCACTCTGGG - Intergenic
1106262658 13:28081193-28081215 CTGAATCACTAGATCAATTTGGG + Intronic
1106613965 13:31309838-31309860 CTGAATAAGGAGGTCTTTCTGGG - Intronic
1106779593 13:33044387-33044409 TTGATTCAGTAGGTCAATCTGGG + Intronic
1110400572 13:75086246-75086268 TTGAATCTGTAGATCAATCTGGG - Intergenic
1112633105 13:101182992-101183014 CTGAAAGAGCAGGTCGACCTGGG + Intronic
1113389472 13:109881582-109881604 CTGACTAAGCATGTCATTCTAGG + Intergenic
1114520756 14:23333700-23333722 CTGAATCTGTAGATCAATTTAGG + Intergenic
1116915589 14:50522232-50522254 CTGTATCCACAAGTCAATCTGGG + Intronic
1117295212 14:54372814-54372836 CTTACTCAGGAGGTCAATGTGGG - Intergenic
1119701130 14:76755592-76755614 CTCATTCAGCAGGTCCATGTGGG - Intergenic
1119822394 14:77628720-77628742 CTGAATCTGTAGATCAATTTGGG - Intergenic
1120399392 14:84009502-84009524 CTCCAACAGCAGGTCACTCTTGG + Intergenic
1122618771 14:103040849-103040871 TTGAATCTGTAGGTCAATTTGGG - Intronic
1125196119 15:37048074-37048096 CTGAATCAACAGGTCTTTCAAGG + Intronic
1127406862 15:58658565-58658587 CTGAATCTGCAGAACAATTTGGG + Intronic
1129344872 15:74910868-74910890 ATGAATCTGCAGGTCTTTCTGGG + Intergenic
1131197515 15:90367404-90367426 GGGAAGCAGCAGGTCATTCTGGG - Intronic
1132730631 16:1359771-1359793 TTGAATCTGCAGATCACTCTGGG + Intronic
1135139836 16:19911949-19911971 CTGAATCAGCAGGTTGAGGTAGG + Intergenic
1135378603 16:21973252-21973274 CTGAGTCAGTAGGTCCATTTTGG + Intronic
1136059351 16:27714875-27714897 CTGAATCTGTAGGTCAGTTTGGG - Intronic
1138578673 16:57925425-57925447 CTGAATCAGCAAGAGAAACTTGG + Intronic
1141273666 16:82564846-82564868 CTGAATCAGGAGATCAGTTTAGG - Intergenic
1142208483 16:88795510-88795532 CTGAATGAGCTGGGCAACCTGGG - Intergenic
1142327671 16:89427337-89427359 CTGAATCATCAGGTCACCCTGGG - Intronic
1143331485 17:6139315-6139337 CTGAATCAGCAGGGCTTTCCTGG - Intergenic
1148453270 17:47795016-47795038 CTGAAGCCACAGGTCACTCTTGG + Intergenic
1149348119 17:55759092-55759114 GTGAACCAGCAGGTGAATCTGGG + Intronic
1152118509 17:78403733-78403755 CTGAATCAGCGGATAAATCCAGG - Exonic
1155427911 18:25725251-25725273 CTGAAACAGGATATCAATCTGGG + Intergenic
1155513602 18:26601582-26601604 TTGAATCTGCAGATCAATTTGGG + Intronic
1158508947 18:58073168-58073190 CTCCATCTGCAGCTCAATCTGGG - Intronic
1159579831 18:70222652-70222674 TTGAATCTGCAGATCAATTTGGG - Intergenic
1160472616 18:79151017-79151039 CTGAATCTACAGATCAATTTAGG - Intronic
1162179092 19:8855012-8855034 CTGCCTCAGCAGGTCAATGAGGG - Intronic
1165876516 19:39011464-39011486 CTGAATCTGTAGATCAATTTAGG + Intronic
1167400367 19:49263507-49263529 CTGAATCTGTAGATCAATTTGGG - Intergenic
1168146640 19:54423096-54423118 CTCATTCAGCAAGTCACTCTTGG + Intronic
927282040 2:21317539-21317561 CACAATGAGCTGGTCAATCTTGG + Intergenic
927285978 2:21357082-21357104 CTGAATCAGCAGGTCTAGGGTGG - Intergenic
928160273 2:28917402-28917424 TTGAATCTGTAGGTCAATTTGGG - Intronic
928851157 2:35748824-35748846 CTGAATCTATAGGTCAATTTGGG - Intergenic
930524670 2:52512815-52512837 CTGAATCATCAGGAACATCTAGG + Intergenic
930790720 2:55325132-55325154 TTGAATCAAGAGATCAATCTGGG + Intronic
932391623 2:71395793-71395815 CTGAGTCTGCAGGTCAGACTTGG + Intronic
933076138 2:77929076-77929098 CTGAATCTACAGATCACTCTGGG + Intergenic
933782264 2:85810972-85810994 CTCACACAGCAGGTCAGTCTGGG + Intergenic
936575781 2:113653715-113653737 TTGAATTTGCAGGTCAATTTGGG - Intergenic
937170829 2:119866496-119866518 CTGAATCAGAAGGTCTACTTTGG + Intronic
937568439 2:123326899-123326921 CTGAATCTGTAGATCACTCTTGG - Intergenic
937858479 2:126690014-126690036 CTGAACCACCAGGTCACTCCAGG - Intronic
937858980 2:126693624-126693646 CTGAACCACCAGGTCACTCCAGG - Intronic
938964857 2:136379409-136379431 CTGACTCAGCAGGTCTAGCTGGG - Intergenic
939409825 2:141810297-141810319 CTGAATCATCAGGGCAGTCAGGG + Exonic
939747922 2:146000854-146000876 CTGAATCTGTAGATCAATTTGGG - Intergenic
939808093 2:146799256-146799278 CTGAATCAGAAGGTCACGGTGGG + Intergenic
942809502 2:179980868-179980890 CTGAATAATCATTTCAATCTGGG + Intronic
943667552 2:190626023-190626045 CTGAATCTGCATCTTAATCTTGG - Intergenic
944968784 2:204967553-204967575 CTGAATCAGCAGGAGAAATTTGG + Intronic
945953198 2:216059956-216059978 CTGAATCTACAGATCAATTTGGG + Intronic
946567155 2:220979411-220979433 CTGAATTACTAGGTTAATCTAGG + Intergenic
946903592 2:224395211-224395233 ATGCATCAGCAGGTGAATCAGGG + Intronic
946983401 2:225244768-225244790 TTGAAAGAGCAGGCCAATCTTGG + Intergenic
947094288 2:226548529-226548551 CAGAATCAGCTGGTGATTCTTGG - Intergenic
947227029 2:227850404-227850426 CTGTATCCCCAGGGCAATCTTGG + Intergenic
1171240301 20:23562556-23562578 CCCAATCAACAGGTCAATCCTGG - Intergenic
1171964565 20:31519607-31519629 CTGAATCAGAAGCTCAAGGTGGG + Intronic
1180003798 21:45009812-45009834 CTGAATGTGCAGATCAATTTGGG + Intergenic
1181563438 22:23718941-23718963 CTGAGTCAAGAGGTCAAGCTGGG - Intergenic
1182412652 22:30200279-30200301 ATGAATCAGCAAGTTAATTTGGG + Intergenic
1183214837 22:36472886-36472908 CAGAACCAGAAAGTCAATCTGGG + Intronic
1184509250 22:44922891-44922913 TTGAATCTGTAGATCAATCTGGG - Intronic
1184621284 22:45680397-45680419 TTGAATCCACAGGTCAATTTGGG - Intronic
949870667 3:8585159-8585181 TTGAATCAACAGGTCAATTTGGG + Intergenic
950405505 3:12801810-12801832 CTGAATCAGCAGGTCTGAGTTGG - Intronic
951616631 3:24553997-24554019 TTGAATCTGCAGATCAATTTTGG + Intergenic
952333939 3:32388990-32389012 CTGATTCAGCAGGTCAGAGTGGG + Intergenic
952559222 3:34570293-34570315 TTGAATCTACAGGTCAATTTGGG + Intergenic
953488093 3:43321881-43321903 CTTAATGAGCAGGTGAATTTTGG + Intronic
954235677 3:49255408-49255430 CTCAAACACCAGGTCATTCTGGG - Exonic
955076617 3:55619866-55619888 CTGAAAGATCAGGTTAATCTAGG + Intronic
956291184 3:67662000-67662022 CTGATTCAGTAGGTCTGTCTTGG + Intergenic
956329668 3:68092262-68092284 TAGAATCAGCAGTTCAATCAGGG - Intronic
958536954 3:95416258-95416280 CTGAATCTGTAGGTCACTTTAGG - Intergenic
958785452 3:98593034-98593056 CAGAATCAGCAGCTCCATCTTGG + Exonic
959367977 3:105487891-105487913 CTGTAACAGTAGCTCAATCTAGG - Intronic
959652886 3:108769017-108769039 CTGTATTCACAGGTCAATCTAGG + Intergenic
960860909 3:122152812-122152834 TTGAATCTGCAGATCAATTTGGG + Intergenic
963047202 3:141111515-141111537 CTGCCTCAACAGTTCAATCTAGG - Intronic
963066112 3:141265902-141265924 CCTAAGCAGCAGGACAATCTGGG + Intronic
963846378 3:150162309-150162331 TTGAATCTGTAGGTCAATTTGGG + Intergenic
965554961 3:170009225-170009247 CTGAATCTGCTGTTCCATCTTGG - Intergenic
967345929 3:188455649-188455671 CAGAATCAGAAGGGCAATGTTGG + Intronic
969116510 4:4873664-4873686 GTGAGTGAGGAGGTCAATCTGGG + Intergenic
969271014 4:6101953-6101975 CTGAATCTGTAGATCAATCATGG + Intronic
972388885 4:38593857-38593879 TTGATTCAGCAGGTCCATGTCGG - Intergenic
972466527 4:39362235-39362257 TTGAATCTGTAGGTCAATTTAGG - Intronic
973977540 4:56278080-56278102 TTGAATCTGTAGCTCAATCTGGG - Intronic
974655779 4:64819137-64819159 TTGAATCTACAGATCAATCTGGG + Intergenic
975173084 4:71255556-71255578 TTGTACCAGCAGGTTAATCTAGG + Intronic
979608204 4:122661793-122661815 AGGAACCAGCAGGTCAGTCTTGG + Intergenic
980669748 4:135988765-135988787 CTGAATCAGAAGCTCAAGATGGG - Intergenic
980721647 4:136705153-136705175 CTGAATCAGCCTGTCCTTCTTGG - Intergenic
981613103 4:146617772-146617794 CTGGGCCAGCAGGTCTATCTGGG + Intergenic
983655384 4:170078523-170078545 CTGAATAAGCAGGTTCATCTAGG + Exonic
983848048 4:172543308-172543330 CCCAATCAGCAGGTAAATTTAGG - Intronic
984259027 4:177422165-177422187 TTGAATCTGCAGGTCAAGTTGGG + Intergenic
984319799 4:178179346-178179368 TTGAATCTGCAGATCAATTTGGG - Intergenic
987188772 5:15451716-15451738 GTGAATCAGCAGCTCCATCCTGG + Intergenic
988819820 5:34871476-34871498 TTAAATCTGCAGATCAATCTTGG - Intronic
989052992 5:37339705-37339727 CTGAATCAGTATATCAATTTGGG - Intronic
989993983 5:50804984-50805006 CAGAATCAACAGCTGAATCTTGG - Intronic
991723145 5:69512613-69512635 TTGAATCTGTAGGTCAATTTTGG + Intronic
994176541 5:96718068-96718090 CTGAATCAACAGGTGAGTCAAGG + Intronic
994846061 5:104989827-104989849 CTGAAACAGGAGGTCACTGTAGG + Intergenic
995230718 5:109759127-109759149 TTAAATCTGTAGGTCAATCTGGG + Intronic
997336375 5:133111733-133111755 CTGATTCAGCAGGTCAGAGTGGG + Intergenic
998181278 5:139946039-139946061 CTGAATCTGTAGATCGATCTGGG - Intronic
999714684 5:154350947-154350969 CTGATTCAGCAGGTCAAGTCTGG + Intronic
1001051758 5:168419575-168419597 TTGATTCAGCAGGTCAAAGTAGG + Intronic
1001386976 5:171347874-171347896 CTGAATCTGTAGGTCACTTTGGG + Intergenic
1003262853 6:4537859-4537881 TTGAATCTGCAGATCAATTTGGG - Intergenic
1005424460 6:25687254-25687276 TTGAATCTGCAGATCAATTTGGG + Intronic
1005678994 6:28186106-28186128 ATTAATGAGCAGGTCTATCTTGG + Intergenic
1007801535 6:44398003-44398025 AAGAATCAGCAGGCCAACCTGGG - Intronic
1010294489 6:74180676-74180698 CTTAAGTAGCATGTCAATCTTGG + Intergenic
1010474059 6:76264484-76264506 CTGAATCAGAATGTGAATTTGGG - Intergenic
1011849886 6:91613195-91613217 CTGAATCTGCATTTCAGTCTGGG + Intergenic
1012580136 6:100857935-100857957 CTGAATCTACAGATCAATTTGGG + Intronic
1012619827 6:101329389-101329411 TTGAATCTGTAGCTCAATCTGGG + Intergenic
1012705969 6:102530898-102530920 TTGAATCAGCAGATCACTTTGGG + Intergenic
1013320548 6:108983808-108983830 TTGAATCTACAGGTCACTCTGGG + Intergenic
1014309105 6:119777311-119777333 CTGAATCTGTAATTCAATCTGGG + Intergenic
1015869281 6:137759753-137759775 CTGGATCATAAGGTCACTCTTGG + Intergenic
1016252184 6:142056990-142057012 CTGAAGCAGAAGGAAAATCTTGG - Intergenic
1017675457 6:156809201-156809223 CTTAATCAGGAGGTCAGTCATGG - Intronic
1017732505 6:157330071-157330093 CTGAATCAGCATGTACTTCTGGG - Intergenic
1021851802 7:24815870-24815892 CAGAGTGAGCAGGTGAATCTCGG + Intronic
1022135679 7:27446107-27446129 TTGAATCTGCAGATCAATTTGGG + Intergenic
1024111622 7:46153017-46153039 GTGAATCATCAGGTCTGTCTTGG + Intergenic
1024763327 7:52627559-52627581 TTGAATCAGTAGTTCAATCAAGG + Intergenic
1025929797 7:65984370-65984392 CTGAGTCAAGAGGTCAAGCTGGG - Intergenic
1026207850 7:68273727-68273749 CTGAGTCAATAGGTCAATATAGG + Intergenic
1026669574 7:72377247-72377269 TTGAGTCTGCAGGTCAATTTGGG + Intronic
1026913435 7:74106072-74106094 CTGAATCAGCAGGTCAATCTGGG - Exonic
1028471448 7:91211128-91211150 CTGAAACTGCAGGGCATTCTTGG + Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1039666074 8:39529789-39529811 CTGAATCTACAGATCAATTTGGG - Intergenic
1039916249 8:41862434-41862456 ATGAATCAGCAGGTCCACCTGGG - Intronic
1039939842 8:42080638-42080660 CTGAATCAGTAGATCAGTTTGGG + Intergenic
1039991670 8:42493252-42493274 CTGAATCAGAAGGTTATTGTGGG - Intronic
1040525516 8:48220540-48220562 TTGAATCTACAGGTCAATTTCGG - Intergenic
1042152819 8:65807102-65807124 CTGAATCTGTAGATCAATTTGGG + Intronic
1042373073 8:68014866-68014888 CTGACTCAGCAGATTAATTTAGG - Intronic
1043139757 8:76573500-76573522 CCGAATCTCCTGGTCAATCTTGG + Intergenic
1045588813 8:103569425-103569447 TTGAATCTGTAGGTCAATTTAGG + Intronic
1046718560 8:117593710-117593732 CAGAATCAGCAAATCAGTCTGGG + Intergenic
1048226592 8:132593497-132593519 TTGAATCTGTAGGTCAATCTGGG - Intronic
1050435650 9:5607103-5607125 CTGAATCTGTAGGTCAAATTGGG - Intergenic
1050900031 9:10935976-10935998 CTTAATCAGCAGATGATTCTAGG + Intergenic
1051807660 9:21013570-21013592 CTGAATCTACAGATCAATTTGGG + Intronic
1055388346 9:75789410-75789432 CTGAATCTGTAGGTCAATTTGGG + Intergenic
1057322454 9:94027007-94027029 CTGACTCAGCAATTCACTCTGGG + Intergenic
1057838094 9:98463318-98463340 CTGAATCTGTAGATCAATTTAGG - Intronic
1186015467 X:5187020-5187042 CAGAATCTGCAGGACACTCTGGG + Intergenic
1186404542 X:9290402-9290424 CTGATTCAGCAGGTCTAGGTCGG + Intergenic
1186976057 X:14906011-14906033 CTGAATCAGTAGATCAATTTGGG - Intronic
1187379872 X:18791303-18791325 TTGAATCTGTAGGTCAATTTGGG + Intronic
1187421880 X:19142120-19142142 CTGAATCTGTAGGTCAACTTGGG - Intergenic
1187954669 X:24505396-24505418 CTGATTCATCAGGTCACTCTGGG + Intronic
1188079658 X:25821517-25821539 CTGAATCTGCAGGTTACTTTGGG - Intergenic
1189867579 X:45347068-45347090 CTCAATCAACAGGTCCTTCTAGG - Intergenic
1192391706 X:70735648-70735670 TTGAATCTGCAGATCAATTTGGG - Intronic
1192678731 X:73229122-73229144 TTGAATCAGTAGATCAATCTGGG + Intergenic
1193368406 X:80662240-80662262 TTGAATCTGTAGGTCAATGTGGG + Intergenic
1193491273 X:82151836-82151858 CTGAATCTGTAGATCAATATGGG - Intergenic
1194235567 X:91379542-91379564 CTGAATCAACAGGCAAATGTGGG + Intergenic
1195335508 X:103849341-103849363 CTGATTTAGCAGGTCAATGTAGG - Intergenic
1196058344 X:111380722-111380744 TTGAATCAGTAGGTCAATTTGGG + Intronic
1198189312 X:134286876-134286898 CTGAATCAGGAGGTCCTTTTGGG + Intergenic
1198318354 X:135493220-135493242 CTGAATATGCAGATCAATTTGGG - Intergenic
1199937830 X:152594008-152594030 CTGAATCTACAGATCAATCTGGG + Intergenic