ID: 1026914409

View in Genome Browser
Species Human (GRCh38)
Location 7:74111488-74111510
Sequence CCTTAGAAGCAGACAGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026914409 Original CRISPR CCTTAGAAGCAGACAGTTGT GGG Intronic
900247812 1:1646716-1646738 CCTGAGAAGCAGAGACTGGTGGG - Intronic
900259039 1:1713870-1713892 CCTGAGAAGCAGAGACTGGTGGG - Intronic
900495350 1:2973624-2973646 CCTGAGAGGCAGACATTTGGGGG + Intergenic
900972193 1:5997888-5997910 TCTTAGCAGCAGACATTTGAAGG + Intronic
901765809 1:11499333-11499355 CCTTAGAAGAAGAAAGCTGATGG - Intronic
902094759 1:13933865-13933887 CCTTAGAGGCAGACAGCCCTGGG - Intergenic
902961917 1:19969615-19969637 TCTTAGATGGAGACAGCTGTGGG + Intergenic
904191910 1:28751739-28751761 CCTTAGAAGCAGAGGGTTTTAGG + Intronic
904431182 1:30465565-30465587 CCTGAGAAGCAAGCAGGTGTTGG - Intergenic
907086054 1:51675272-51675294 ACTTAGTTCCAGACAGTTGTAGG + Intronic
907307703 1:53522526-53522548 CCCTGGAAGCAGACAGGTCTGGG + Intronic
907553138 1:55321156-55321178 CCTGAGAAGCAGCCTGTTGTAGG + Intergenic
908199703 1:61781624-61781646 CTTTAGAATCAGACAGATGAAGG + Intronic
908224688 1:62044292-62044314 TCATAGAAGCAGAGAGTAGTGGG - Intronic
908273723 1:62447111-62447133 CTTTAAAAGAAGTCAGTTGTAGG - Intronic
912774611 1:112497527-112497549 CCTCAGAAGCAGAATGTTATTGG - Intronic
913233024 1:116757382-116757404 CCTTAGAAGCAGATGCTAGTAGG + Intronic
915303391 1:154964088-154964110 CTCTAGAAAGAGACAGTTGTAGG + Intronic
917431966 1:174979309-174979331 CCTTTGAAGCAGACACTGGTTGG + Intronic
919241234 1:194919272-194919294 CTTTAGAAGCAGACAGGTCTAGG - Intergenic
921168870 1:212527820-212527842 CCTTAGAGGCTGACAGTCTTGGG - Intergenic
924181670 1:241445180-241445202 GCTTAGAAGAAGAGAGCTGTAGG + Intergenic
924356647 1:243184305-243184327 CCTTGTAAGCAGACAGATCTGGG - Intronic
1063173871 10:3534449-3534471 CCTTTGCAGCAGACTGTGGTAGG + Intergenic
1063922654 10:10947705-10947727 CCTTGAAAGCAGAAAGTTGAAGG - Intergenic
1065206908 10:23365624-23365646 ACTTAGAAAGAGACATTTGTAGG - Intergenic
1068919506 10:62467392-62467414 GCTGAGTAGCAGAAAGTTGTTGG + Intronic
1069298681 10:66879137-66879159 CTTTGGAGCCAGACAGTTGTGGG - Intronic
1073501902 10:103947292-103947314 CCTTTGAAGTAGACAGTGTTTGG - Intergenic
1076052014 10:127342738-127342760 CTTTAGAAGAAGAAAGTTGTAGG - Intronic
1079178645 11:18168789-18168811 CCATGGAAGAAGACAGTTCTTGG - Intronic
1079573944 11:21979814-21979836 CTTTGGAATCAGACAGATGTGGG + Intergenic
1080229190 11:29999355-29999377 CATTAGAAGCAGACAGATCCTGG - Intergenic
1080442329 11:32306180-32306202 CCTTAGTAGCAGGATGTTGTGGG - Intergenic
1080857718 11:36126543-36126565 CCCCAGAAGAAGCCAGTTGTTGG + Intronic
1081756773 11:45550224-45550246 CCTGAGATGGAGACAGCTGTGGG + Intergenic
1085150829 11:74251761-74251783 TCTGACAAGCAGACACTTGTAGG + Intronic
1091174728 11:133547760-133547782 CCTGAGAAGCAGTCAGCTGGAGG - Intergenic
1092254943 12:6921722-6921744 CTTGAGCAGCAGACAGTTGCAGG - Exonic
1097724697 12:63061894-63061916 ACTTGGAATCAGACAGATGTGGG + Intergenic
1098877392 12:75880652-75880674 CCTAAAAAGCAGACAGTTCATGG + Intergenic
1100039373 12:90295306-90295328 CTTTAGAAGCAGACAATGGAAGG - Intergenic
1100793150 12:98152609-98152631 TTTTAAAAGCAGACTGTTGTAGG - Intergenic
1101502571 12:105317681-105317703 GGTTAGCAGCAGCCAGTTGTGGG + Intronic
1101620968 12:106387702-106387724 TCTTAGAATCAGACAGATTTAGG + Intronic
1101754865 12:107613467-107613489 CCTTAGAATCTGACAGATTTGGG + Intronic
1102778902 12:115546556-115546578 ACTTAAAAGCAGAAAGATGTAGG + Intergenic
1104452738 12:128884353-128884375 TCATAGAAGCAGAGAGTAGTAGG + Intronic
1105804483 13:23944815-23944837 CCTCACAAGCAGACATTTGAAGG - Intergenic
1106677909 13:31981137-31981159 CCTTACACACAGACAGTTCTTGG - Intergenic
1107469770 13:40681205-40681227 CATTAGAAGGAGAAAGTTTTTGG + Intergenic
1107490153 13:40873921-40873943 GTTTAGAAGCAAACAGGTGTTGG - Intergenic
1108699289 13:52930142-52930164 CCTTGGAAGCAGACATTTGTAGG - Intergenic
1108771531 13:53707793-53707815 CTTTAGAAACAGAAAGCTGTGGG + Intergenic
1111299683 13:86331730-86331752 CCTTAGAAGCAGCAAGGTGCAGG - Intergenic
1116039954 14:39674013-39674035 CCTTAGAAGCATGGAGTAGTAGG - Intergenic
1116089659 14:40288883-40288905 GTTTAAAATCAGACAGTTGTAGG + Intergenic
1116845530 14:49861848-49861870 CCTTATAAGGAGGCAGTAGTGGG + Intergenic
1121942347 14:98083104-98083126 CCTGAGAACCAGAGAGTTGATGG - Intergenic
1123994560 15:25709613-25709635 CCTGAGAAGCAGACACCTGTGGG - Intronic
1126886265 15:53154301-53154323 CTTTAAAAGCAGACTGATGTGGG + Intergenic
1128657071 15:69470186-69470208 GCTTAGGAGCAGCCAGTTGGAGG + Intergenic
1128697800 15:69781492-69781514 ACTTGGAAGCACACAGTTTTGGG - Intergenic
1129641027 15:77378140-77378162 CCTTAGAAACTTACAGTTTTAGG - Intronic
1130801589 15:87269522-87269544 CCTTAGCAGATGACAGTAGTGGG - Intergenic
1131356842 15:91752579-91752601 CCTTAGAAGAGGACAGTAGGTGG - Intergenic
1136110351 16:28060736-28060758 CCTTTGAGGCAGACACTTCTAGG - Intronic
1136514500 16:30759810-30759832 CTTCAGAAGCAGACAGATCTGGG + Exonic
1140311341 16:73851351-73851373 CCTCAGGAGAGGACAGTTGTTGG - Intergenic
1140732759 16:77871391-77871413 CACTAGAAGGAGACACTTGTGGG - Intronic
1141950107 16:87334569-87334591 CCTTTCAGGCAGACAGATGTGGG - Intronic
1143176109 17:4956083-4956105 CTTCAGCAGCAGACAGTTGCAGG - Exonic
1145796445 17:27658261-27658283 ACTTGGAACCAGACAGTTGCAGG + Intergenic
1145810881 17:27763536-27763558 ACTTGGAACCAGACAGTTGCAGG + Intronic
1146548084 17:33756363-33756385 CCTTATCACCAGAAAGTTGTTGG + Intronic
1148994735 17:51699839-51699861 ATTTATAAGCAGACAGTTGTAGG + Intronic
1150536827 17:66051546-66051568 CTTTAGGGTCAGACAGTTGTGGG - Intronic
1150894145 17:69190116-69190138 CATGGGAAGCAGACAGATGTTGG + Intronic
1154140381 18:11818432-11818454 CCTTAGAAACAGGCAGTTTCAGG - Intronic
1155070769 18:22314067-22314089 CCTTAGAAGCAGGCTGATGGGGG - Intergenic
1157235439 18:45961009-45961031 CCTGAGAAGGAGAAAGCTGTGGG - Intronic
1157365937 18:47064382-47064404 CCTAAGAAGCAGGGAGTGGTGGG + Intronic
1159193516 18:65080938-65080960 CCTTAGAAGCTGAATGTTCTAGG - Intergenic
1161706839 19:5826210-5826232 GCATCGAAGCAGACATTTGTGGG - Intronic
1161785410 19:6322065-6322087 CCTTTGAAGAAAACAGGTGTTGG - Intronic
1164322669 19:24163982-24164004 CCTTAGAAGGAGACAGTGTGTGG - Intergenic
1166855235 19:45779982-45780004 CCTGGGAAGCAGACAGTCCTAGG - Exonic
924977906 2:194920-194942 GCTTGGAAGCAGACGGCTGTGGG - Intergenic
925488348 2:4362544-4362566 TCTTAGAAGCAGAGAGTAGATGG - Intergenic
926182932 2:10661809-10661831 CCTTAGAAGCTGTCACTTCTAGG - Intronic
928713726 2:34036266-34036288 CTTGAGAAGAGGACAGTTGTGGG - Intergenic
931392283 2:61854413-61854435 TGTTAGAAGGAGACAGTTGATGG + Intergenic
933155749 2:78971452-78971474 CCATAGCAACAGACAGTTCTGGG + Intergenic
935070446 2:99689230-99689252 CCTAAGAAGCAGCCAGTGTTAGG - Intronic
938868534 2:135450118-135450140 CTTTGGAAGGAGACAGATGTTGG - Intronic
941993838 2:171582704-171582726 TCATAGAAGCAGAGAGTAGTTGG - Intergenic
942316098 2:174697708-174697730 CCTTAGAAGAAAACAGTAGCTGG - Intergenic
942464929 2:176197711-176197733 CCTTGGAAGCAGACAGGCTTGGG + Intergenic
945560155 2:211329889-211329911 CCTAAGCAGCAGAGAGTTGTTGG - Intergenic
946142668 2:217704930-217704952 CCTTTGGATCAGACAGGTGTTGG - Intronic
1170456852 20:16541654-16541676 CCAGAGAAGCAGACATCTGTGGG + Intronic
1172631735 20:36383130-36383152 CTTTAGAAGCACAGAGTTGCTGG + Intronic
1174455793 20:50647954-50647976 CCTTAGCAGCACAAAGTGGTAGG - Intronic
1181028849 22:20140510-20140532 CCTTAGAAGCTGATACTTGCGGG - Intronic
1182179479 22:28331256-28331278 CTTCAGAGGCAGACAGTTCTGGG - Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
949730904 3:7111549-7111571 CCTCAGAAACAGTCAGTTGGAGG - Intronic
951897564 3:27624734-27624756 GCTTAGAAGCATTCAGCTGTTGG - Intergenic
955091562 3:55756695-55756717 GCTTAGAAACAGACAGTTGTTGG - Intronic
955484632 3:59423331-59423353 CCCTAGAAGCAGGCACGTGTGGG - Intergenic
955953386 3:64264141-64264163 GCTTGGAATTAGACAGTTGTAGG + Intronic
958892670 3:99797732-99797754 CCTTAGAAGCGGACTGTGGAAGG + Exonic
964736635 3:159924953-159924975 CCTGAGACGCAGACATTTGTAGG + Intergenic
969155928 4:5209874-5209896 CTTTGGAAGTAGACAGTTGGGGG - Intronic
969283872 4:6190461-6190483 CCTTAGGAGCAGCCAGAGGTAGG + Intronic
969844057 4:9905598-9905620 CCTTAAAAGCTGACAATTTTGGG - Intronic
971378469 4:26074475-26074497 CATCAGAATCAGACAGTTCTGGG + Intergenic
971476537 4:27077833-27077855 CCTAAGAAGAAGTCAGTTGGAGG + Intergenic
972627062 4:40809720-40809742 TCTTAGAATCAGAAATTTGTGGG - Exonic
975660313 4:76681961-76681983 CCAGAGAAGCAGAGAGTTGAGGG - Intronic
978758423 4:112329023-112329045 CTCTAGAAGCACACATTTGTGGG - Intronic
979887981 4:126055511-126055533 CCTAAGAAGATGACATTTGTTGG + Intergenic
980521511 4:133941898-133941920 ACTGAGAAGCAGAAAATTGTGGG - Intergenic
983674361 4:170275061-170275083 CCCTAGTAGGAGACATTTGTAGG - Intergenic
986054143 5:4119288-4119310 CCTAAGGAGCAGACAGTAGGAGG + Intergenic
986495546 5:8338372-8338394 CCTTGGAATCAGGCAGATGTTGG - Intergenic
994664402 5:102690300-102690322 CCATAGCAGAAGACAGTTGCAGG - Intergenic
995495072 5:112733245-112733267 ACTAGGAAGCAGACATTTGTAGG - Intronic
999468417 5:151829169-151829191 GCTGAGAAGCAGACAGCAGTGGG - Intronic
1000926163 5:167197242-167197264 CTTTGGAAGGAGACAGCTGTGGG - Intergenic
1010824175 6:80452691-80452713 GATTAGAAGCAGAATGTTGTAGG + Intergenic
1011782902 6:90809977-90809999 ACTTAGAAGAAGACTATTGTAGG + Intergenic
1012353159 6:98278414-98278436 ACTGAGAACCAAACAGTTGTTGG - Intergenic
1013910408 6:115269775-115269797 CTGTAGAAGCAGGCAGCTGTGGG - Intergenic
1017053003 6:150410611-150410633 CCTTAGAAGCGGGAAATTGTGGG + Intergenic
1018818504 6:167354557-167354579 CTTTAGAAGCAGACAATGGAAGG - Intronic
1021804126 7:24338424-24338446 TCTTGGAAGGAGACAGTTTTGGG + Intergenic
1022104236 7:27186788-27186810 CCTTCCAAGAAGAGAGTTGTTGG - Intergenic
1022203891 7:28144443-28144465 CCTGAGAGGCAGACATTTGCAGG + Intronic
1022329070 7:29360616-29360638 CCTTATAAGCAGGGAATTGTAGG - Intronic
1024303377 7:47904921-47904943 GCTTTGAAGCAGACAGTCCTAGG - Intronic
1026914409 7:74111488-74111510 CCTTAGAAGCAGACAGTTGTGGG + Intronic
1028205676 7:88013995-88014017 CCTTAGAAGGAGAGGGTAGTAGG - Intronic
1030962298 7:115940787-115940809 CCTGAGACACAGTCAGTTGTTGG + Exonic
1031594041 7:123627032-123627054 CCTTAAAAACAGCCTGTTGTGGG - Intronic
1035826289 8:2647466-2647488 CCTTGGACGCAGTCAGTTTTTGG - Intergenic
1037586574 8:20280784-20280806 CCTTAGATCCAGCCAGTTCTGGG + Intronic
1037959596 8:23086035-23086057 CCTGAGAAGCAGCCAGCTGTGGG + Intronic
1039661134 8:39468035-39468057 CCTTAGAAGGAGATATTTTTGGG + Intergenic
1041472372 8:58225138-58225160 CTTTAGTAGCTGACAGTTGGCGG + Intergenic
1041752889 8:61280473-61280495 CCTTGGAAACAGGCAGATGTGGG + Intronic
1042113604 8:65407974-65407996 GGTTAGGAGCAGACAGATGTGGG - Intergenic
1043256587 8:78146321-78146343 CTTGGGAAGCAGACAGATGTGGG - Intergenic
1043910690 8:85859862-85859884 CCTTAGATTCAGACAGATGTAGG + Intergenic
1044448408 8:92305112-92305134 CCTATGATGCAGAAAGTTGTAGG + Intergenic
1047651360 8:126926231-126926253 CCTTGGAGTCAGACAGATGTGGG - Intergenic
1048036618 8:130683197-130683219 GCAGAGAAGCAGACAGTTGGAGG - Intergenic
1048302559 8:133262283-133262305 ACTTAGAAGAACACAGATGTTGG + Intronic
1050991174 9:12154292-12154314 CATTATAAGCAAACAGTTGTTGG + Intergenic
1051390672 9:16559882-16559904 CTTCAAAAGCAGACAGATGTAGG + Intronic
1051567152 9:18513336-18513358 ACATAGAAGCAGACAGTAGAAGG - Intronic
1051604066 9:18903629-18903651 CCTTAGAAGGAAACTGTGGTTGG - Intronic
1052142998 9:25010923-25010945 CCTCAGCAGCAGAAAGTTGGGGG - Intergenic
1055178426 9:73350920-73350942 TCATAGAAGCAGACAGTAGAAGG - Intergenic
1055320116 9:75075145-75075167 TCATAGAAGCAGTCAGTTATTGG - Intronic
1056684497 9:88748390-88748412 TCTTAGAAGCAGAAAGTAGAAGG - Intergenic
1056697933 9:88876038-88876060 CCTTAAAAGCAGACATGTGATGG - Intergenic
1056934280 9:90903875-90903897 CCACAGCAGCAGGCAGTTGTGGG - Intergenic
1057166056 9:92926286-92926308 CCTTGGATGTAGGCAGTTGTGGG + Intergenic
1058904920 9:109474806-109474828 CATCAGAATCAGACAGCTGTGGG + Intronic
1059750090 9:117239430-117239452 CCAGAGAAGCAGGCAGATGTTGG + Intronic
1187170870 X:16850551-16850573 CCTTTAAAGCAGACAGTTGGGGG - Intronic
1188707452 X:33353337-33353359 TTTTAGAAGCATACAGTTATAGG + Intergenic
1192170594 X:68852172-68852194 CCTTGGAAGCAGAGAGTCCTGGG - Intergenic
1192588732 X:72341837-72341859 ACATAGAAACAGCCAGTTGTGGG - Intronic
1197640270 X:128959622-128959644 CCTTAGCAGCAGACTTTTGCTGG + Intergenic
1201783043 Y:17744252-17744274 ACTTAGAAAAAGACACTTGTGGG - Intergenic
1201818510 Y:18161735-18161757 ACTTAGAAAAAGACACTTGTGGG + Intergenic
1202174404 Y:22084483-22084505 ACTTAGAAAAAGACACTTGTAGG - Intronic
1202216956 Y:22501899-22501921 ACTTAGAAAAAGACACTTGTAGG + Intronic
1202326231 Y:23694171-23694193 ACTTAGAAAAAGACACTTGTAGG - Intergenic
1202544541 Y:25975883-25975905 ACTTAGAAAAAGACACTTGTAGG + Intergenic