ID: 1026915310

View in Genome Browser
Species Human (GRCh38)
Location 7:74116501-74116523
Sequence CTGAAATCAAGACGCCGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 294}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026915305_1026915310 -3 Left 1026915305 7:74116481-74116503 CCAGCGTCAGCCTCACCGGGCTG 0: 1
1: 0
2: 0
3: 23
4: 335
Right 1026915310 7:74116501-74116523 CTGAAATCAAGACGCCGGTAGGG 0: 1
1: 0
2: 2
3: 46
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026915310 Original CRISPR CTGAAATCAAGACGCCGGTA GGG Intronic
900711995 1:4120209-4120231 CTGAAATCAAGGTGCAGGCAGGG + Intergenic
901028369 1:6291453-6291475 CTGAAATCAAGGCGTCAGCAGGG - Intronic
901178948 1:7326703-7326725 CTGAAATCAAGGTGCTGGCAGGG - Intronic
902446123 1:16465726-16465748 CTGAAATCAAGATGCCAGTAGGG + Intergenic
902726658 1:18340676-18340698 CTGAAATCAAGGTGTCAGTAGGG + Intronic
906955703 1:50371865-50371887 CTGAAATCAAGGTGTCGGTTAGG + Intergenic
907881306 1:58551396-58551418 CTGAAATGAAGATGCCAGCATGG - Intergenic
912464548 1:109862561-109862583 CTGAAATCAAGGTGCTGGCAGGG + Intergenic
915503200 1:156334519-156334541 CTGAAATAAAGGCGTCAGTAGGG - Intronic
917129865 1:171730109-171730131 CTAAAATCAAGGTGCCAGTAGGG - Intronic
917419813 1:174851072-174851094 CTGAAATCAAGATGCCTGTTGGG - Intronic
919089028 1:192956148-192956170 CTGAACTCAAGATGTCGGCAAGG - Intergenic
920562660 1:206949912-206949934 CTGAAATCAAGGTGCCAGCAGGG + Intergenic
920839611 1:209543317-209543339 CTGAAATCAAGGTGTTGGTAGGG - Intergenic
920957522 1:210633014-210633036 CTGAAATCAAGGAGCCAGCAGGG - Intronic
921320891 1:213937361-213937383 CTGAAATCAAGGCGTTGGCAAGG - Intergenic
921590731 1:217000272-217000294 CTGAAATCAAGATGTCAGCAGGG + Intronic
921953492 1:220958081-220958103 CTGAAATCAAGGTGCCAGCATGG + Intergenic
922659814 1:227420008-227420030 CTGAAATCAAGGTGCCGGCAGGG + Intergenic
1064007474 10:11709970-11709992 CTGAAATCAAGGCATCGGCAGGG + Intergenic
1064522169 10:16214457-16214479 CTGAAATCAAGATGTTGGGAGGG - Intergenic
1064522731 10:16220290-16220312 CTGAAATCAAGGTGTTGGTAAGG - Intergenic
1065127704 10:22590152-22590174 CTGAGATCAAGGTGCCAGTATGG - Intronic
1066690768 10:38025580-38025602 CTGAGATCAGGACGCCAGCATGG - Intronic
1070406959 10:76105686-76105708 CTGAAATCAAGAAGTCTGCAGGG - Intronic
1071021157 10:81058810-81058832 CTGAAATCAAGATGTGGGTGGGG + Intergenic
1071374190 10:84985900-84985922 CTGAAATCAAGATGTTGGCAGGG - Intergenic
1072527338 10:96285047-96285069 CTGAAATCAAGGTGTCAGTAGGG + Intergenic
1073267194 10:102234848-102234870 GTGAAAGCAAGATGCAGGTATGG - Intronic
1073474193 10:103742201-103742223 CTGAAATCAAGGTGCCAGCAGGG + Intronic
1074290176 10:112132452-112132474 CTGAAATCAAGGTGTCGGCAGGG + Intergenic
1075903442 10:126061800-126061822 CTGAAATCAAGATACTGGCAAGG - Intronic
1076228221 10:128798005-128798027 CTGAAATCCAGATGCCAGCAGGG - Intergenic
1076488207 10:130837765-130837787 CTGCAATCAAGGCGCTGGCAGGG - Intergenic
1076918657 10:133440143-133440165 CTGAAAGCAACATGCCGGTGGGG - Intergenic
1078153839 11:8781234-8781256 CTGAAGTCAATAGGCAGGTAAGG + Intronic
1079887892 11:26011731-26011753 CTGAAATCAAGATGCTGGTAGGG - Intergenic
1080045706 11:27805496-27805518 CTGAAATCAAGGTGTCGGCAGGG - Intergenic
1080207461 11:29747239-29747261 CTGAAATCAGGATGCCAGTATGG + Intergenic
1080391862 11:31855404-31855426 CTGAAATCAAGGTGTCAGTAAGG - Intronic
1080415710 11:32068140-32068162 CTGAAATCGAGATGTCGGCATGG - Intronic
1080657402 11:34268707-34268729 CTGAAATCAAGGTGTCGGCAGGG + Intronic
1083807849 11:65085538-65085560 CTGAAAGCAACATGCCGGTCTGG - Intronic
1084436255 11:69142740-69142762 CTGAAATCAAGATGGCGGCTGGG + Intergenic
1084746577 11:71173935-71173957 CTGAAATCAAGGCATCGGCAGGG - Intronic
1087723387 11:101692133-101692155 CTGAAATCAAGGGGCTGGCAAGG - Intronic
1088120192 11:106360180-106360202 CTGAAATCAAGAGGTCAGCAGGG - Intergenic
1088314643 11:108495587-108495609 CAGAAATCAAGAGGCCTGAAAGG + Intronic
1088876118 11:113937903-113937925 CTGAAATCAAGACTTGGGCAGGG + Intronic
1091269815 11:134300150-134300172 CTGAAATCAAGGTGCTGGCAGGG + Intronic
1091824276 12:3498882-3498904 CTGAAATCCAGATGCCAGCAGGG + Intronic
1094320617 12:29178918-29178940 CTGAGATCAAGATGCTGGCAGGG + Intronic
1095820211 12:46470221-46470243 CTGAGATCAGGAAGCCAGTATGG - Intergenic
1097987374 12:65798149-65798171 CTGCAATCAAGACACCAGCAGGG - Intergenic
1098998976 12:77154549-77154571 CTGAAATCAAGATGTTGGCAGGG - Intergenic
1099164186 12:79281900-79281922 CTGAAATCAAGGCGTCAGCAGGG + Intronic
1099652667 12:85448148-85448170 CTGAAATGAAGAGGTCAGTAGGG + Intergenic
1099842035 12:87977871-87977893 CTGAAATCAAGTTGCTAGTAGGG - Intergenic
1099904706 12:88758455-88758477 CTGAAATCAAGGTGCTGGCAGGG + Intergenic
1101601481 12:106213811-106213833 CTGAAATCAAGGCGTTGGTAGGG - Intergenic
1102817277 12:115877246-115877268 CTGAAATCAAGACACTGGCCAGG + Intergenic
1102888960 12:116543304-116543326 CTGAAATCAAGGTGCAGGCAGGG + Intergenic
1102935247 12:116891073-116891095 CTGAAGTCAAGATGTCAGTAGGG - Intergenic
1104077094 12:125399585-125399607 CTGAAATCAAGGTGTTGGTAGGG - Intronic
1108260343 13:48649486-48649508 CAGAAATCAAGATGCCAGCAGGG + Intergenic
1109070341 13:57758127-57758149 CTGTAATCAACACGAAGGTAAGG - Intergenic
1110535587 13:76647260-76647282 CTGAAATCAAGGTGTCGGCAGGG - Intergenic
1110541102 13:76707839-76707861 CTGAAATCAAGATGCTGGTGTGG - Intergenic
1111440297 13:88273786-88273808 CTGCAATCAAGACGGCAGTCGGG - Intergenic
1111717659 13:91899843-91899865 CTGAAATCAAGATGTTGGCAGGG - Intronic
1111958575 13:94784265-94784287 CTGAAATCAAGGCTCTGGCAGGG - Intergenic
1112582196 13:100686174-100686196 CTGAAATCAAGGTGCAGGCAGGG + Intergenic
1112715708 13:102182350-102182372 CTAAAATCAAGGCGTCGGCAGGG - Intronic
1113135344 13:107082959-107082981 CTGAAATCAAGGTGTCTGTAGGG - Intergenic
1114356964 14:21921219-21921241 CTGAAATCAAGGAGTCAGTAAGG + Intergenic
1114743053 14:25117942-25117964 CTAAAATCAAGGCACCGGCAAGG - Intergenic
1115475299 14:33807698-33807720 CTGAAATCAAGGTGCCAGCAAGG + Intergenic
1115620961 14:35139811-35139833 CTGAAATCAAGATGTTGGCAAGG + Intronic
1115762915 14:36593621-36593643 CTGAAATCAAGATGTCGGCAGGG + Intergenic
1116072449 14:40066000-40066022 CTGAAATCAAGAAGATAGTAAGG - Intergenic
1116773449 14:49153046-49153068 CTGAAATCAATCCGCCTGTAAGG - Intergenic
1116871273 14:50071025-50071047 CTGAAATCAAGGTGTCGGCAGGG + Intergenic
1117483759 14:56173596-56173618 CTGAAATCAAGGTGTCGGCAGGG + Intronic
1118112379 14:62736018-62736040 CTGAAATCAAGACTTCAGCAGGG - Intronic
1118869233 14:69727416-69727438 CTGAAATCAAGGCGTGGGCAGGG + Intronic
1119603226 14:75991800-75991822 CTGAAAGCAAGATGCCAGTTAGG + Intronic
1120838242 14:89060310-89060332 CTGAAATCAAAATGCTGGCAGGG + Intergenic
1122261870 14:100528241-100528263 CTGAAATCAAGATGTTGGCAGGG + Intronic
1124111675 15:26795834-26795856 CTGAAATCAACACGCAGGCAGGG + Intronic
1124908863 15:33898411-33898433 CTGAAATCAACATGCTGGCAAGG + Intronic
1125459223 15:39892789-39892811 CTGAAATCAAGCTGCCGGCAGGG - Intronic
1126479863 15:49106120-49106142 CTGAAATCAAGGTGCTGGCAGGG + Intronic
1126681082 15:51202747-51202769 CTGAAATCAAGGTGTCGGCATGG - Intergenic
1126729565 15:51668852-51668874 CTGAAATCAAGGCGTCGGAAAGG - Intergenic
1128757324 15:70191867-70191889 CTAAAATCAAGGAGCCGGCAGGG + Intergenic
1129176923 15:73847020-73847042 CTGAAATCAAGGTGCTGGTGGGG - Intergenic
1129705141 15:77790071-77790093 CTGAAATCAAGGTGTCGGCAGGG - Intronic
1130885941 15:88092664-88092686 CTGAAATCAAGGCATCAGTAGGG + Intronic
1131284319 15:91044484-91044506 CTGACATCAAGGTGCTGGTAGGG + Intergenic
1131337045 15:91559086-91559108 CTGAAATCAAGGTGTCAGTAGGG - Intergenic
1133456738 16:5948725-5948747 CTGAAATCAAAGCACTGGTAGGG - Intergenic
1134374453 16:13658842-13658864 CTGAAATCAGGGAGCCAGTAGGG + Intergenic
1134564624 16:15240534-15240556 CTGAAATCAAGGTGTCAGTAGGG + Intergenic
1134929630 16:18195995-18196017 CTGAAATCAAGGTGTCAGTAGGG + Intergenic
1136275222 16:29175807-29175829 CTGAAATCAAGGTGTCGGCAGGG - Intergenic
1138649888 16:58453882-58453904 CTGAAATCAAGATGTCGGCAGGG + Intergenic
1138718305 16:59049066-59049088 CTGAAATCAAGATGTTGGCAGGG - Intergenic
1138909046 16:61374466-61374488 CTGAAATCAAGGTGTCAGTAGGG + Intergenic
1139374668 16:66489442-66489464 CTGAAATGAAGACACAGGTAAGG - Intronic
1140764176 16:78140464-78140486 CTGAAATCAAGGTGTTGGTAGGG + Intronic
1140778629 16:78273863-78273885 CTGAATTCATGACGCCTGTGGGG + Intronic
1140948266 16:79791527-79791549 CTGAAATCAAGGTGCCGGCAGGG + Intergenic
1141192656 16:81835749-81835771 CTGAAATCAAGGTGTTGGTAGGG + Intronic
1141276012 16:82588931-82588953 CTGAAATCAAGACGTCAGCAGGG - Intergenic
1141493641 16:84391700-84391722 CTGAAACCAAGATGCTGGCAGGG - Intronic
1142023688 16:87800818-87800840 CTGAAATCAAGGTACCAGTAGGG - Intergenic
1142079583 16:88141875-88141897 CTGAAATCAAGGTGTCGGCAGGG - Intergenic
1143877356 17:10002182-10002204 CTGAAATCAAGATACTGGCAGGG + Intronic
1144444121 17:15310588-15310610 CTGAGATCAAGGTGCCGGCAGGG - Intronic
1146734640 17:35227906-35227928 CTGAAATCAAGTTGTCAGTAGGG - Intergenic
1148957218 17:51363807-51363829 CTGAAATCAAGGTGTCGGCAGGG + Intergenic
1149381463 17:56098206-56098228 CTGAAATCAGGACTTCAGTAGGG - Intergenic
1149445850 17:56712746-56712768 CTGAAATCAAGGTGTCGGCAAGG - Intergenic
1149450016 17:56742738-56742760 CCGAAATCAAGAGGCTGGTGGGG - Intergenic
1150804997 17:68311755-68311777 CTGAAATCAAGATGTCGGCCGGG - Intronic
1151259064 17:72902461-72902483 CTGAAATCATGGCGTCAGTAGGG - Intronic
1151953737 17:77370218-77370240 CTGAAATCAAGGTGCCAGCAGGG + Intronic
1153197351 18:2615073-2615095 TTGAAATCAAGACGTCAGCAGGG - Intronic
1153501497 18:5754705-5754727 CTGAAATCAAGATGTCAGCAGGG + Intergenic
1155336077 18:24766693-24766715 CTGAAATCAAGATGTCAGCAAGG - Intergenic
1156430246 18:37064877-37064899 CTGAAGTCAAGACGTTGGGAGGG - Intronic
1157440361 18:47707006-47707028 CTGAAATCAAGGTGTTGGTAAGG - Intergenic
1159347124 18:67220507-67220529 CTGAAATCAAGATGCTGGCAGGG - Intergenic
1163088134 19:14997805-14997827 CTGAAATCAAGGTGTTGGTAGGG + Intronic
1163116887 19:15194410-15194432 CTGAAATCAAGATATCGGCAGGG - Intronic
1164632681 19:29771926-29771948 CCGAAATCAAGGTGCCGGCAGGG - Intergenic
1165064386 19:33220479-33220501 CTGAAAAGGAGAAGCCGGTAAGG - Intronic
1165279482 19:34784097-34784119 CTGAAATGAAGACGTTGGTAGGG + Intergenic
926942717 2:18155082-18155104 CTGAAATCAAGGCACCTGCAGGG - Intronic
927327350 2:21820413-21820435 CTGAAATCAAGGTGCCGGTCTGG + Intergenic
928588922 2:32793045-32793067 ATGAAATCAAGATGTGGGTAAGG + Intronic
929047786 2:37806822-37806844 CTGAGATCAAGACACCAGCAGGG - Intergenic
930285686 2:49424622-49424644 CTGAAATCAAGAGGCTGGCAGGG - Intergenic
930394467 2:50802951-50802973 CTGAAATCAAGATGTTGGCAGGG - Intronic
931363742 2:61600676-61600698 CTAAAATCAAGATGTTGGTAGGG - Intergenic
931800216 2:65750756-65750778 CTAAAATCAAGATGTTGGTAAGG + Intergenic
933320361 2:80768497-80768519 CTGAAATCAAGATGTTGGGAGGG + Intergenic
934054310 2:88239309-88239331 CTGAAATCAAGGTGTCGGCAGGG + Intergenic
934847080 2:97668543-97668565 CTGAGATCAAGACGTCAGCAGGG - Intergenic
935190266 2:100772036-100772058 CTGAGATCAAGACGTTGGTAGGG + Intergenic
935741720 2:106154615-106154637 CTGAAATCAAGATGTCAGCAGGG - Intronic
936119671 2:109730652-109730674 CTGAGATCAAGATGCCAGCATGG + Intergenic
937127218 2:119482350-119482372 CTGAAATCAGGACGCCTGTGGGG + Intronic
938717900 2:134037512-134037534 CTGAAATCAAGGTGTCGGCAGGG + Intergenic
939408933 2:141799032-141799054 CTGAAATCAAGGTCTCGGTAGGG - Intronic
940122800 2:150286399-150286421 CTGAAATCAAGGTGTCGGCAGGG + Intergenic
940259067 2:151761644-151761666 CTGAAATCAAGGCGTCAGAAGGG - Intergenic
941195792 2:162449741-162449763 CTGAAATCAAGATGTGGGCAAGG - Intronic
943258045 2:185622028-185622050 CTGAAATCAATATGACAGTAGGG - Intergenic
945579361 2:211573287-211573309 TTGAAATCAAGATGTTGGTAGGG - Intronic
946657145 2:221960709-221960731 CTGAAGTCAAGATGCTGGCAGGG + Intergenic
948080546 2:235202190-235202212 CTGCAATCAAGAGGCTGGCAGGG + Intergenic
948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG + Intronic
948647126 2:239412373-239412395 CTGAAATCAAGGCGTCGGTCAGG + Intergenic
1168815360 20:733073-733095 CTGAAATCAAGGTGCTGGCAAGG - Intergenic
1169319000 20:4615853-4615875 CTGAAATCAAGGTGCCGGCAGGG + Intergenic
1170018891 20:11813759-11813781 CTGAAATCAAGGTGTCGGCAGGG - Intergenic
1172870449 20:38132334-38132356 CAGAAATCAAGATCCGGGTAAGG - Exonic
1173474733 20:43351065-43351087 CTGAAATCAAGGTGTTGGTAGGG - Intergenic
1174037969 20:47679684-47679706 CTGAAATCAAGGTGCCGGCCAGG - Intronic
1174194744 20:48764977-48764999 CTGAAATCAAGGTGCCAGCAGGG - Intronic
1174851961 20:54004295-54004317 CTGAAATCAAGATGCCAGCATGG - Intronic
1175568433 20:59999674-59999696 CTGAAATCCAGAAGCAAGTAAGG - Intronic
1177006938 21:15685483-15685505 CTAAAATCAAGATGTCGGGAAGG + Intergenic
1179312963 21:40213027-40213049 CTGAAATCAAGAAGTCAGCAGGG - Intronic
1179356207 21:40662798-40662820 CTGAGATCAAGATGCCCGCAGGG - Intronic
1179541801 21:42087798-42087820 CTGAAATCAAGGTGTCGGCAGGG + Intronic
1181096777 22:20510489-20510511 CTGAAATCAAGACGTTGGCAGGG + Intronic
1182416676 22:30225787-30225809 CTGAAATCAAGGTGCCAGCAGGG + Intergenic
1183036938 22:35147651-35147673 CTGAAATCAAGGTGCCGGCAGGG - Intergenic
1183209957 22:36444801-36444823 CTGAAATCAAGACGTCAGCAGGG - Intergenic
949663767 3:6313255-6313277 CTGAAATAAAGATGGCAGTAGGG + Intergenic
949804996 3:7944980-7945002 CAGAATTCAAGAGGCCAGTAAGG - Intergenic
952018440 3:28987816-28987838 CTGAAATCAAGATGTCAGGAGGG + Intergenic
952034758 3:29186856-29186878 CTGAAATCAAGGTGTTGGTAAGG + Intergenic
953123103 3:40065064-40065086 CTGAAATCAAGGTGCAGGCAGGG + Intronic
954990592 3:54837632-54837654 CTGAAATCAAGATGTCAGCAGGG + Intronic
955251788 3:57290202-57290224 CTGAAATCAAGATGTCAGCAGGG + Intronic
955737534 3:62055626-62055648 CTGAGATCAAGATGTCTGTAGGG + Intronic
956588814 3:70891731-70891753 CTGAAATCAAGACGTCAGCGGGG - Intergenic
956708761 3:72022273-72022295 CTGAGATCAAGATGTCGGCAGGG - Intergenic
956763375 3:72463188-72463210 CTGAAATGAAGAGGCCAGTGAGG - Intergenic
956811959 3:72872148-72872170 CTGAAATCAAAATGCCAGCAAGG + Intergenic
957424856 3:80024352-80024374 CTGAAATCAAGGTGTCAGTAGGG - Intergenic
957705279 3:83772195-83772217 CTGAAATCAAGGTGTTGGTAGGG + Intergenic
959160759 3:102721579-102721601 CTGAAATCAAGATGTCAGTAAGG - Intergenic
960995481 3:123337473-123337495 CTGAGATCAAGGAGTCGGTAGGG + Intronic
962024216 3:131529843-131529865 CTGAAATCAAGGTGTCAGTAGGG - Intergenic
963435852 3:145265427-145265449 CTGATATCAGGATGCCAGTATGG + Intergenic
964539314 3:157761683-157761705 CTGAAATCAAGATGCTGGAAGGG - Intergenic
967018555 3:185502987-185503009 CTGAAATCAGGAGCCTGGTAAGG + Intergenic
969977093 4:11114785-11114807 CTGAAATCATGATGCCAGCAGGG + Intergenic
970075721 4:12217255-12217277 CTGAAATCAAAGCGCCAGCAGGG + Intergenic
970314303 4:14814861-14814883 CTACAATCAAGACGCCAGCAGGG + Intergenic
970384398 4:15541907-15541929 CTGAAATCAAGGCGTCAGTAGGG + Intronic
970476697 4:16430900-16430922 CTGAAATCAAGGTGTCGGTGGGG + Intergenic
970858761 4:20677952-20677974 CTGCAATCAAGGCGTCGGCAGGG - Intergenic
971285195 4:25282208-25282230 CTGAAATCAAGGTGCCAGTAGGG + Intergenic
971323829 4:25627875-25627897 CTGAAATCAAGGTGCTGGCAGGG + Intergenic
971356247 4:25897680-25897702 CTGAAATCTAGATGGCGGCAGGG + Intronic
971640402 4:29124603-29124625 CTGACATCAAGACACCAGTTTGG - Intergenic
971830206 4:31682904-31682926 CTGAAATCAAGACGTTGTTCAGG + Intergenic
972041095 4:34600763-34600785 CTGAAATCAAGATGTCAGTAGGG + Intergenic
973121654 4:46528002-46528024 CTAAAATCAAGATGTCTGTAAGG - Intergenic
973957385 4:56076238-56076260 CTGAGATCAAGGTGCCGGCAGGG - Intergenic
974134286 4:57795180-57795202 CTGAAATCAAGGTGTTGGTAGGG + Intergenic
974815200 4:66995319-66995341 CTGAGATCAAGATGCCAGCATGG + Intergenic
977295087 4:95201071-95201093 CTGAGATCAAGATGCCAGCATGG - Intronic
978764655 4:112391747-112391769 CTGAAATCAAGACGTCAGTGGGG - Intronic
979580116 4:122348176-122348198 CTGAAATGCAGATGCCGGTTGGG - Intronic
981737015 4:147963710-147963732 CTGAAATCAAGACGTTGGGAGGG + Intronic
981831877 4:149011093-149011115 CTGAAATCAAGATGCTGGCCAGG - Intergenic
982823847 4:159977616-159977638 CTGAGATCAAGGTGCCTGTATGG + Intergenic
983886199 4:172983273-172983295 CTGAAATCAAGCTGTCGGCAGGG - Intronic
984191133 4:176607037-176607059 CTGAAACCAAGGCGTCGGCAAGG - Intergenic
984702397 4:182826607-182826629 CTGAAATCAAGGCGCGGGCAGGG + Intergenic
986292957 5:6415070-6415092 CTGAAATCAAGGTGCCAGCAGGG + Intergenic
986714151 5:10510571-10510593 CCAAAATCAAGACGCTGGCAGGG + Intronic
987306751 5:16644601-16644623 CTAAAATCAAGATGCCAGCAGGG + Intergenic
987723959 5:21672789-21672811 CTAAAATCAAGATGCTGGCAGGG - Intergenic
988293638 5:29325075-29325097 CTGAAATCAAGATGGTGGCAGGG - Intergenic
988322305 5:29714052-29714074 TTGAGATCAAGATGCCAGTAGGG - Intergenic
992970960 5:82057356-82057378 CTGAAATCAAGATGTTGGCAGGG + Intronic
994049261 5:95344082-95344104 CTGAAATCAAGGTGCCAGCAGGG + Intergenic
994412045 5:99418997-99419019 CTGAAATCAAGACACAGGAGTGG - Intergenic
994481779 5:100346263-100346285 CTGAAATCAAGACACAGGAGTGG + Intergenic
995888444 5:116922139-116922161 CTGAAATCAAGGAGGCGGCAGGG - Intergenic
997434731 5:133866093-133866115 CTGAAATCAAGGTGCAGGCAGGG - Intergenic
999487704 5:152015677-152015699 CTGAAATCAAGATGTTGGTAGGG - Intergenic
1000715880 5:164643737-164643759 CTGAAATCAAGGGGTTGGTAGGG + Intergenic
1000788864 5:165580192-165580214 CTGAAATCAAGGTGTCTGTAGGG - Intergenic
1001138213 5:169120537-169120559 CTGAAATCAAGATGTTGGCAGGG - Intronic
1001832956 5:174804928-174804950 CTGAAATCAAGATGTTGGTATGG + Intergenic
1002329500 5:178431694-178431716 CTGAAATCAAGATGGTGGCAGGG - Intronic
1003976953 6:11353527-11353549 CTGAAATCAAGGTGCTGGCAGGG - Intronic
1005213380 6:23495974-23495996 CTGAAATCAAGGCGTCAGCAGGG - Intergenic
1006265848 6:32922739-32922761 CTGAGATCAAGGCGCCAGCATGG - Intergenic
1007290327 6:40780876-40780898 CTGAAATCAAGATGTCAGTTGGG - Intergenic
1008538473 6:52526029-52526051 CTGAAATCAAGATGGTGGCAGGG - Intronic
1010321751 6:74518338-74518360 CTAAAATCAAGGTGCCAGTAGGG - Intergenic
1010671276 6:78689577-78689599 CTGAGATCAGGATGCCAGTATGG - Intergenic
1011656201 6:89554210-89554232 CTGAAATCAAGCCACTGGTGAGG + Intronic
1013508847 6:110826491-110826513 CTGAAATCAAGATGTCTGGAGGG + Intronic
1014735896 6:125095993-125096015 CTGAAATCAAGATGTTGGCAGGG - Intergenic
1016771775 6:147860083-147860105 CTGAAATCAAGTTGCCAGCAGGG + Intergenic
1016860204 6:148710322-148710344 CTGAAATCAGGATGCCAGCATGG + Intergenic
1017317865 6:153053006-153053028 CTGAGATCAAGGTGCCAGTATGG - Intronic
1017495648 6:154980840-154980862 CTGAAATCAAAGTGTCGGTAGGG - Intronic
1018290625 6:162289129-162289151 CTGAAATCAAGGCATCGGCAGGG + Intronic
1018369114 6:163150669-163150691 CTGAAATCATGACCCGGGTACGG - Intronic
1019125481 6:169837843-169837865 CTGAAATCAAGGTGTCGGCAGGG - Intergenic
1019677988 7:2327040-2327062 CTGAAATCAAGTTGCCGGCAGGG + Intronic
1020347991 7:7185461-7185483 CTGAAATCAAGATGTAGGTATGG + Intronic
1020468970 7:8513896-8513918 CTGAAATCAAGATGTTGGCAAGG + Intronic
1021816106 7:24449102-24449124 CTGAAATCAAGACATCAGTGGGG + Intergenic
1023892159 7:44400641-44400663 CTGAAATCAAGGTGTCAGTAGGG + Intronic
1024941319 7:54765980-54766002 CTGAGATCAAGATGCCAGCAAGG - Intergenic
1026198158 7:68190810-68190832 CTGAAATCAAGGTGCAAGTAGGG - Intergenic
1026915310 7:74116501-74116523 CTGAAATCAAGACGCCGGTAGGG + Intronic
1027359664 7:77394855-77394877 CAGAAAGCAAGACACAGGTAGGG + Intronic
1027508311 7:79046397-79046419 CTGAGATCAAGATGTCTGTAGGG - Intronic
1027589946 7:80105903-80105925 CTGAAATCAAGATGACAGCAGGG - Intergenic
1030761173 7:113353807-113353829 CTAAAATCAAGATGTTGGTAGGG - Intergenic
1031297691 7:120024216-120024238 CTGAAATCAAGGTCCCGGGAAGG + Intergenic
1032297161 7:130649981-130650003 CTAAAATCAAGATATCGGTAGGG + Intronic
1032490436 7:132320241-132320263 CTGGAATCAAGGGGCCGGTAGGG + Intronic
1033132101 7:138753390-138753412 CTGAAATCAAGGCGTCAGCAGGG - Intronic
1034152171 7:148925608-148925630 CTGAAATCAAGATGTCAGTAGGG - Intergenic
1034209892 7:149354341-149354363 CTGAAATCAAGTTGTCGGCAAGG - Intergenic
1035408372 7:158616879-158616901 CAGAAAGCAAGACGGTGGTAAGG + Intergenic
1035568763 8:658924-658946 CTGAAATCCAGAGCCTGGTAAGG - Intronic
1036988214 8:13560909-13560931 CTGAAATCAAGGCATCAGTAGGG - Intergenic
1037648150 8:20812516-20812538 CTGAAATCAAGGTGCTGGCAGGG - Intergenic
1038869405 8:31478184-31478206 CTGAAATCAAGGTGTTGGTAGGG + Intergenic
1039133311 8:34292509-34292531 CTGAAATCAAGATGTCAGCAGGG - Intergenic
1039854487 8:41400450-41400472 CTGAAATCAAGGTGCCTGCAGGG - Intergenic
1040660823 8:49573269-49573291 CTGGAAGCAAGACCCCAGTATGG - Intergenic
1040896560 8:52374430-52374452 CTGATATCAAGATGCCAGCAGGG - Intronic
1040914028 8:52550622-52550644 CTGAAATCAAGATGTGGGCAGGG + Intronic
1041139188 8:54796716-54796738 CTGAAATCAAGACGTCAATGAGG - Intergenic
1041860341 8:62505874-62505896 CTAAAATCAAGACTCTGGCAGGG + Intronic
1042456281 8:69007770-69007792 CTGAAATCAAGGTGCTGGCAGGG + Intergenic
1042458131 8:69029326-69029348 CTGAAATCAAGATGGCAGTAGGG - Intergenic
1042733558 8:71963245-71963267 CTGAGATCAGGGTGCCGGTATGG + Intronic
1042801793 8:72726288-72726310 CTGAGATCAAGGTGCCAGTATGG - Intronic
1042869565 8:73386054-73386076 CTGAAATCAAGATGCCAGCTGGG - Intergenic
1044046664 8:87443808-87443830 CTGAAATCAAGTTGTCAGTAGGG - Intronic
1044059337 8:87615145-87615167 CTGAAATCAAGTTGCCAGCATGG - Intronic
1044474436 8:92609547-92609569 CTGAAATCAAGGCGTCAGCAGGG + Intergenic
1044785612 8:95789215-95789237 CTGAAATCAAGGTGTTGGTAGGG - Intergenic
1045349911 8:101329310-101329332 CTGAAATCAAGATGTCGGCAGGG + Intergenic
1045496530 8:102714211-102714233 CTGAAATCAAGATGTCAGCAGGG + Intergenic
1046042221 8:108919553-108919575 CTGAAATCAAGATGTCAGCAAGG - Intergenic
1046675225 8:117100558-117100580 CTGGAAACAAGAAGCCAGTATGG + Intronic
1046917775 8:119695198-119695220 CTGAGATCAAGATGGCGGCAGGG - Intergenic
1047003529 8:120596505-120596527 CTGAAATCAAGATGTCAGCATGG + Intronic
1047407354 8:124596683-124596705 CTGAAATCCAGATGTCGGCAGGG + Intronic
1047873797 8:129113223-129113245 CTGAAATCAAGATGTTGGCAGGG - Intergenic
1047942613 8:129840195-129840217 CTGAAATCAAGATATTGGTAGGG + Exonic
1048421129 8:134279353-134279375 CTGAAATCAAGGTGCTGGCAGGG - Intergenic
1048732102 8:137454154-137454176 CTAAAATCAAGACGTCAGCAGGG + Intergenic
1050189001 9:3005400-3005422 CTGAAATCAAGATGTCTGCAGGG - Intergenic
1051686073 9:19659302-19659324 CTGAAATCAAGGTGCTGGAAGGG - Intronic
1051890938 9:21942305-21942327 CTGAGATCAAGGTGCTGGTAAGG + Intronic
1051963240 9:22793942-22793964 CTAAAATCAAGATATCGGTAGGG + Intergenic
1053276061 9:36784215-36784237 CTGAAATCAAGGTGCTGGCAGGG + Intergenic
1056223015 9:84468407-84468429 CTGAAATCAAGGTGTCAGTAGGG - Intergenic
1056489098 9:87087409-87087431 CTGAAATCAAGGTGCTGGCAGGG - Intergenic
1056783150 9:89566495-89566517 CTGAAATCAAGATGGCAGCAGGG - Intergenic
1056879705 9:90379561-90379583 CTGAAATCAAGGTGCTGGCAGGG - Intergenic
1057333193 9:94135399-94135421 CTGACATCAAGGTGTCGGTAGGG + Intergenic
1057931056 9:99193377-99193399 CTGAAATCAAGGTGTCGGCAAGG - Intergenic
1058920292 9:109608145-109608167 CTGAAATCAAGATGTCAGCAGGG + Intergenic
1059199463 9:112400686-112400708 CTGAAATCAAGATGTCAGCAGGG + Intronic
1059410344 9:114127923-114127945 CTGAAATCAAGGAGCCAGCAGGG + Intergenic
1059948474 9:119437616-119437638 CTGAAATCAAGATGTTGGTAGGG + Intergenic
1060507275 9:124207582-124207604 CTGAAATCAAGGCGGCAGCAGGG + Intergenic
1062263164 9:135673386-135673408 CTGAAATCCAGATGTCGGCAGGG + Intergenic
1185918589 X:4063624-4063646 CTGAAATGAAGATGTCGGCAGGG - Intergenic
1186314233 X:8351372-8351394 CTGAAATCAAGCTGCTGGCAGGG + Intergenic
1186686540 X:11930575-11930597 CTGAAATCAAGATGTCTATAAGG - Intergenic
1187587330 X:20677888-20677910 CTGAAATCAAGATGTCAGCAGGG - Intergenic
1189009847 X:37036110-37036132 CTGAAATCAGGATGCCAGCATGG + Intergenic
1189038726 X:37519605-37519627 CTGAAATCAGGATGCCAGCATGG - Intronic
1189622586 X:42857846-42857868 CTGAAATCAAGATGTCAGCAGGG + Intergenic
1189631200 X:42955235-42955257 CTAAAATCAAGATGTAGGTAAGG - Intergenic
1192531332 X:71889377-71889399 CTGAAATCAAGGTGTTGGTAGGG - Intergenic
1193565301 X:83068517-83068539 CTGAAATCAAGATGCTGGTTGGG - Intergenic
1197422081 X:126249997-126250019 CTGAAATCAAGATGTCAGCAGGG + Intergenic
1197657828 X:129136693-129136715 CTAAAATCAAGATGCAGGTAGGG - Intergenic
1198453476 X:136792006-136792028 CTGAAATCAAGCTGTCAGTAGGG + Intergenic
1198807314 X:140504794-140504816 CTGAACTCAAGAACCCCGTAGGG - Exonic
1199809959 X:151339384-151339406 CTGAAATCAAGATGTTGGCAGGG + Intergenic