ID: 1026920800

View in Genome Browser
Species Human (GRCh38)
Location 7:74153933-74153955
Sequence TTGAATTTGGACCTAGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026920800_1026920805 -8 Left 1026920800 7:74153933-74153955 CCACTTCCTAGGTCCAAATTCAA No data
Right 1026920805 7:74153948-74153970 AAATTCAAGGTATGGAATCCAGG No data
1026920800_1026920810 27 Left 1026920800 7:74153933-74153955 CCACTTCCTAGGTCCAAATTCAA No data
Right 1026920810 7:74153983-74154005 TTCTATCTTGACCTCCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026920800 Original CRISPR TTGAATTTGGACCTAGGAAG TGG (reversed) Intergenic
No off target data available for this crispr