ID: 1026920802

View in Genome Browser
Species Human (GRCh38)
Location 7:74153939-74153961
Sequence CATACCTTGAATTTGGACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026920802_1026920812 28 Left 1026920802 7:74153939-74153961 CCTAGGTCCAAATTCAAGGTATG No data
Right 1026920812 7:74153990-74154012 TTGACCTCCACCAAGGACCTGGG No data
1026920802_1026920811 27 Left 1026920802 7:74153939-74153961 CCTAGGTCCAAATTCAAGGTATG No data
Right 1026920811 7:74153989-74154011 CTTGACCTCCACCAAGGACCTGG No data
1026920802_1026920810 21 Left 1026920802 7:74153939-74153961 CCTAGGTCCAAATTCAAGGTATG No data
Right 1026920810 7:74153983-74154005 TTCTATCTTGACCTCCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026920802 Original CRISPR CATACCTTGAATTTGGACCT AGG (reversed) Intergenic
No off target data available for this crispr