ID: 1026920804

View in Genome Browser
Species Human (GRCh38)
Location 7:74153946-74153968
Sequence TGGATTCCATACCTTGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026920804_1026920810 14 Left 1026920804 7:74153946-74153968 CCAAATTCAAGGTATGGAATCCA No data
Right 1026920810 7:74153983-74154005 TTCTATCTTGACCTCCACCAAGG No data
1026920804_1026920812 21 Left 1026920804 7:74153946-74153968 CCAAATTCAAGGTATGGAATCCA No data
Right 1026920812 7:74153990-74154012 TTGACCTCCACCAAGGACCTGGG No data
1026920804_1026920815 29 Left 1026920804 7:74153946-74153968 CCAAATTCAAGGTATGGAATCCA No data
Right 1026920815 7:74153998-74154020 CACCAAGGACCTGGGAGACCTGG No data
1026920804_1026920811 20 Left 1026920804 7:74153946-74153968 CCAAATTCAAGGTATGGAATCCA No data
Right 1026920811 7:74153989-74154011 CTTGACCTCCACCAAGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026920804 Original CRISPR TGGATTCCATACCTTGAATT TGG (reversed) Intergenic
No off target data available for this crispr