ID: 1026920806

View in Genome Browser
Species Human (GRCh38)
Location 7:74153966-74153988
Sequence ATAGAAGGAAGTGGTTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026920806_1026920820 20 Left 1026920806 7:74153966-74153988 CCAGGCCAACCACTTCCTTCTAT No data
Right 1026920820 7:74154009-74154031 TGGGAGACCTGGACAAGGGCAGG No data
1026920806_1026920815 9 Left 1026920806 7:74153966-74153988 CCAGGCCAACCACTTCCTTCTAT No data
Right 1026920815 7:74153998-74154020 CACCAAGGACCTGGGAGACCTGG No data
1026920806_1026920811 0 Left 1026920806 7:74153966-74153988 CCAGGCCAACCACTTCCTTCTAT No data
Right 1026920811 7:74153989-74154011 CTTGACCTCCACCAAGGACCTGG No data
1026920806_1026920817 15 Left 1026920806 7:74153966-74153988 CCAGGCCAACCACTTCCTTCTAT No data
Right 1026920817 7:74154004-74154026 GGACCTGGGAGACCTGGACAAGG No data
1026920806_1026920812 1 Left 1026920806 7:74153966-74153988 CCAGGCCAACCACTTCCTTCTAT No data
Right 1026920812 7:74153990-74154012 TTGACCTCCACCAAGGACCTGGG No data
1026920806_1026920821 21 Left 1026920806 7:74153966-74153988 CCAGGCCAACCACTTCCTTCTAT No data
Right 1026920821 7:74154010-74154032 GGGAGACCTGGACAAGGGCAGGG No data
1026920806_1026920810 -6 Left 1026920806 7:74153966-74153988 CCAGGCCAACCACTTCCTTCTAT No data
Right 1026920810 7:74153983-74154005 TTCTATCTTGACCTCCACCAAGG No data
1026920806_1026920818 16 Left 1026920806 7:74153966-74153988 CCAGGCCAACCACTTCCTTCTAT No data
Right 1026920818 7:74154005-74154027 GACCTGGGAGACCTGGACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026920806 Original CRISPR ATAGAAGGAAGTGGTTGGCC TGG (reversed) Intergenic
No off target data available for this crispr