ID: 1026920810

View in Genome Browser
Species Human (GRCh38)
Location 7:74153983-74154005
Sequence TTCTATCTTGACCTCCACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026920806_1026920810 -6 Left 1026920806 7:74153966-74153988 CCAGGCCAACCACTTCCTTCTAT No data
Right 1026920810 7:74153983-74154005 TTCTATCTTGACCTCCACCAAGG No data
1026920804_1026920810 14 Left 1026920804 7:74153946-74153968 CCAAATTCAAGGTATGGAATCCA No data
Right 1026920810 7:74153983-74154005 TTCTATCTTGACCTCCACCAAGG No data
1026920800_1026920810 27 Left 1026920800 7:74153933-74153955 CCACTTCCTAGGTCCAAATTCAA No data
Right 1026920810 7:74153983-74154005 TTCTATCTTGACCTCCACCAAGG No data
1026920802_1026920810 21 Left 1026920802 7:74153939-74153961 CCTAGGTCCAAATTCAAGGTATG No data
Right 1026920810 7:74153983-74154005 TTCTATCTTGACCTCCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026920810 Original CRISPR TTCTATCTTGACCTCCACCA AGG Intergenic
No off target data available for this crispr