ID: 1026920812

View in Genome Browser
Species Human (GRCh38)
Location 7:74153990-74154012
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026920804_1026920812 21 Left 1026920804 7:74153946-74153968 CCAAATTCAAGGTATGGAATCCA No data
Right 1026920812 7:74153990-74154012 TTGACCTCCACCAAGGACCTGGG No data
1026920802_1026920812 28 Left 1026920802 7:74153939-74153961 CCTAGGTCCAAATTCAAGGTATG No data
Right 1026920812 7:74153990-74154012 TTGACCTCCACCAAGGACCTGGG No data
1026920808_1026920812 -8 Left 1026920808 7:74153975-74153997 CCACTTCCTTCTATCTTGACCTC No data
Right 1026920812 7:74153990-74154012 TTGACCTCCACCAAGGACCTGGG No data
1026920807_1026920812 -4 Left 1026920807 7:74153971-74153993 CCAACCACTTCCTTCTATCTTGA No data
Right 1026920812 7:74153990-74154012 TTGACCTCCACCAAGGACCTGGG No data
1026920806_1026920812 1 Left 1026920806 7:74153966-74153988 CCAGGCCAACCACTTCCTTCTAT No data
Right 1026920812 7:74153990-74154012 TTGACCTCCACCAAGGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026920812 Original CRISPR TTGACCTCCACCAAGGACCT GGG Intergenic