ID: 1026920815

View in Genome Browser
Species Human (GRCh38)
Location 7:74153998-74154020
Sequence CACCAAGGACCTGGGAGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026920807_1026920815 4 Left 1026920807 7:74153971-74153993 CCAACCACTTCCTTCTATCTTGA No data
Right 1026920815 7:74153998-74154020 CACCAAGGACCTGGGAGACCTGG No data
1026920804_1026920815 29 Left 1026920804 7:74153946-74153968 CCAAATTCAAGGTATGGAATCCA No data
Right 1026920815 7:74153998-74154020 CACCAAGGACCTGGGAGACCTGG No data
1026920808_1026920815 0 Left 1026920808 7:74153975-74153997 CCACTTCCTTCTATCTTGACCTC No data
Right 1026920815 7:74153998-74154020 CACCAAGGACCTGGGAGACCTGG No data
1026920806_1026920815 9 Left 1026920806 7:74153966-74153988 CCAGGCCAACCACTTCCTTCTAT No data
Right 1026920815 7:74153998-74154020 CACCAAGGACCTGGGAGACCTGG No data
1026920809_1026920815 -6 Left 1026920809 7:74153981-74154003 CCTTCTATCTTGACCTCCACCAA No data
Right 1026920815 7:74153998-74154020 CACCAAGGACCTGGGAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026920815 Original CRISPR CACCAAGGACCTGGGAGACC TGG Intergenic
No off target data available for this crispr