ID: 1026925921

View in Genome Browser
Species Human (GRCh38)
Location 7:74193545-74193567
Sequence CTGTTGGTTGCGCACTCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 49}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026925921_1026925926 3 Left 1026925921 7:74193545-74193567 CCCCCTGAGTGCGCAACCAACAG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1026925926 7:74193571-74193593 CAAGCTCATTTGTTTAATTATGG 0: 1
1: 0
2: 4
3: 30
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026925921 Original CRISPR CTGTTGGTTGCGCACTCAGG GGG (reversed) Intronic
900314130 1:2048680-2048702 GTGTTGGTTGGGAGCTCAGGGGG + Intergenic
904035213 1:27555382-27555404 CCTTTGGTTGCCCACCCAGGTGG + Intronic
905092529 1:35440955-35440977 CTGTTAGTGACACACTCAGGAGG + Intronic
1070734461 10:78853796-78853818 CTAATGGTTGCCCACCCAGGAGG - Intergenic
1073438193 10:103535190-103535212 CTGTTGTTTGGGCACTGAGGGGG + Intronic
1080474949 11:32581741-32581763 CTGTGGGCTGGGCACTGAGGTGG + Intergenic
1081672945 11:44951608-44951630 CTGTCAGTTGCGCTGTCAGGAGG + Intergenic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1085886980 11:80533046-80533068 CTGGTGGGTGCGGGCTCAGGGGG - Intergenic
1088152187 11:106758328-106758350 CTGCTGGTTGCGAACACAGTGGG + Intronic
1094035286 12:26063907-26063929 GGGTTGGTGGAGCACTCAGGTGG + Intronic
1104727253 12:131085646-131085668 CTGTCGGTTGCGCTCACAGAAGG + Intronic
1106100223 13:26688478-26688500 CCGATGGCTGCGCACACAGGAGG + Exonic
1110930245 13:81206226-81206248 GTGATGGTTGTGCACACAGGAGG - Intergenic
1112893257 13:104265173-104265195 CTGTTGGTTGCAATCTCAGCTGG + Intergenic
1112996511 13:105580861-105580883 CTGTTGGCTGGGAACTCAGCCGG - Intergenic
1121101104 14:91250953-91250975 CTGTTGGTTAGGCAGTCAGAGGG - Exonic
1124594093 15:31079502-31079524 CTTTTGCTTGCGCACTCAGAGGG - Intronic
1127381929 15:58438095-58438117 CTTTTGGCTGCGCACTCATTTGG - Intronic
1128518169 15:68356878-68356900 CTGTTGGCTGAGAGCTCAGGTGG - Intronic
1137825360 16:51489883-51489905 CCGTGGGTTGGGCACCCAGGAGG + Intergenic
1138346137 16:56321388-56321410 GTGTTGGCTGCACACTCAGAGGG + Intronic
1140322162 16:73963410-73963432 CTGTTGGTTGGGACCTCAGCTGG - Intergenic
1143474360 17:7194241-7194263 CTGTTGGCTGCCCACCCCGGGGG + Intronic
1147749255 17:42718555-42718577 ATGTTGGGTGTGCACTGAGGGGG + Exonic
1153419400 18:4886876-4886898 CTGCAGGCTGAGCACTCAGGTGG - Intergenic
1165457919 19:35925543-35925565 CTGTTGGTTTCGAGCTCAGCTGG - Intergenic
933493454 2:83018194-83018216 CTGTTGGTTAAGTACTCAGTTGG + Intergenic
943674255 2:190701625-190701647 CTTTTATTTGAGCACTCAGGAGG + Intergenic
944328430 2:198435622-198435644 CTGTTGGTTCAGTACTTAGGGGG + Intronic
1169802274 20:9522474-9522496 CCGTTGGCTGCTTACTCAGGAGG - Intronic
1171010712 20:21507960-21507982 CGGTCGGTTGCGAAATCAGGGGG + Intergenic
1175386954 20:58603374-58603396 CTCTTAGGTGCTCACTCAGGGGG - Intergenic
1178821818 21:35982417-35982439 CTCTTGGTGGGGCAGTCAGGGGG - Intronic
1182573342 22:31255466-31255488 GTGTTTGTTGAGCACCCAGGAGG + Intronic
952980805 3:38733961-38733983 CTGTTGGAGGCGCAGGCAGGCGG - Intronic
1019637818 7:2085815-2085837 CTCTTGGGTGCGCACTTAGAAGG + Intronic
1023968030 7:44973424-44973446 CTCTGGGCTGCCCACTCAGGTGG - Intronic
1025192321 7:56905291-56905313 CTGTTGCTTGGGAACTCAAGAGG + Intergenic
1025679628 7:63671640-63671662 CTGTTGCTTGGGAACTCAAGAGG - Intergenic
1026925921 7:74193545-74193567 CTGTTGGTTGCGCACTCAGGGGG - Intronic
1033128677 7:138726722-138726744 CTGTTGGTTGTTTCCTCAGGCGG - Intronic
1037136365 8:15466853-15466875 CTGTTAATTGCTCACTCAGAGGG + Intronic
1042507247 8:69573745-69573767 GTGTTGGTTGATCACACAGGGGG - Intronic
1044038671 8:87337627-87337649 CTGTTGGTTGCACACTTTTGTGG + Intronic
1047570499 8:126093799-126093821 GTGTTGGTTCCACTCTCAGGAGG - Intergenic
1052357763 9:27523340-27523362 GTGTTTGTTGTGCACTGAGGAGG - Intronic
1055728852 9:79260351-79260373 ATGTTGGTGGCACATTCAGGTGG - Intergenic
1195167865 X:102238380-102238402 GTGTTGGTGGCAAACTCAGGGGG + Intergenic
1195190992 X:102448707-102448729 GTGTTGGTGGCAAACTCAGGGGG - Intronic
1197474942 X:126910390-126910412 CTGTTGGTTGGGGACCTAGGAGG + Intergenic
1199582772 X:149376849-149376871 CTGTTGGGTGTTCATTCAGGAGG - Intergenic
1201404426 Y:13635568-13635590 CTGTTTGTTGAGCACGGAGGAGG - Intergenic