ID: 1026926238

View in Genome Browser
Species Human (GRCh38)
Location 7:74195906-74195928
Sequence TTCCTATTTAGAGGGAGTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 2, 1: 0, 2: 1, 3: 10, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026926231_1026926238 23 Left 1026926231 7:74195860-74195882 CCTTGTTTTCACAACTAGGATAA 0: 3
1: 0
2: 1
3: 15
4: 244
Right 1026926238 7:74195906-74195928 TTCCTATTTAGAGGGAGTCCTGG 0: 2
1: 0
2: 1
3: 10
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026926238 Original CRISPR TTCCTATTTAGAGGGAGTCC TGG Exonic
901407307 1:9057888-9057910 TTGCTGTTTAGAGGGAATCCGGG - Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
908382987 1:63613975-63613997 TTCCAATTTATTGTGAGTCCTGG + Intronic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
911610051 1:99950740-99950762 TTTCTATTTGGTGGGGGTCCAGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912484799 1:110017758-110017780 TTCCTTCCTAGAGGGAGTCTTGG + Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
918023682 1:180720937-180720959 TTCAAATTTAGAAGGAGGCCAGG + Intronic
920664805 1:207955233-207955255 TTACTATTTAGAGGGAATCATGG - Intergenic
920759362 1:208767382-208767404 TTCCTGTTTAGAGGTTGTCAGGG + Intergenic
922984299 1:229854014-229854036 TTCCTATTAAGAGGAAGACCTGG + Intergenic
923647008 1:235833826-235833848 TTCCTCTTGAGAGGGAATCTTGG + Intronic
1064120962 10:12618694-12618716 TTGGTATTTAGAGGGATTCATGG + Intronic
1067665901 10:48278952-48278974 CTCCTATTTATAGAGAGTTCTGG + Intergenic
1070219076 10:74421649-74421671 GTCATATTTAAAAGGAGTCCTGG - Intronic
1072474407 10:95745918-95745940 TTCCTATTTCCAGGTAGTCAGGG - Intronic
1072548288 10:96457303-96457325 GTCCTATATAGAGGGAGGCTGGG - Intronic
1073390776 10:103174572-103174594 TTCTTTTTTTGAGGGAGTGCTGG - Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081508575 11:43744149-43744171 TTCCAATTTATAGGGATTCTAGG + Intronic
1084679821 11:70660451-70660473 GTCCTCTCTACAGGGAGTCCAGG + Intronic
1091345265 11:134848191-134848213 TTGCCATTTAGAGGAAGTGCAGG + Intergenic
1091990002 12:4947554-4947576 TTCCTATTTATTGTGAGCCCTGG + Intergenic
1093016045 12:14155705-14155727 TTCTTTTTGAGAGGGAGTCTTGG - Intergenic
1093766144 12:22965292-22965314 TTGCTATTTAGAAGCAGGCCTGG - Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096110233 12:49024428-49024450 TTCCTAATTAGAGGGCATGCAGG - Intronic
1096965470 12:55623590-55623612 TTGGTATTTGTAGGGAGTCCTGG - Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097534590 12:60850844-60850866 TTCCTATATAGAATGAGTTCAGG - Intergenic
1098548737 12:71739841-71739863 TTTCTTTTTAGATGGAGTCTTGG + Intergenic
1100814575 12:98373849-98373871 TTACTATTTAGAATGACTCCTGG + Intergenic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1106039749 13:26078340-26078362 TTCCTATGAAGAAGGAGACCAGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1110962253 13:81641790-81641812 TTAATATTTAAAGGGAGGCCTGG + Intergenic
1118647035 14:67850641-67850663 TTCCTATTTTACGGGAGTGCTGG + Intronic
1118680192 14:68233184-68233206 TATCTATTTAGATGGAGTACAGG + Intronic
1119821356 14:77618786-77618808 TTCCTGTTTACATGGAGTCTGGG - Intergenic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1121691117 14:95877482-95877504 CTCTTATTTAGTGGGTGTCCAGG + Intergenic
1122616230 14:103019882-103019904 TTCCTATTTAAAGGGAGCACTGG - Intronic
1122837119 14:104435788-104435810 TTCCCAGTTAGCGGGGGTCCTGG - Intergenic
1125143717 15:36440802-36440824 TTCCAATTCAGTGGCAGTCCTGG + Intergenic
1126344971 15:47683764-47683786 TTCCTATTCCCTGGGAGTCCAGG + Intronic
1126654645 15:50963942-50963964 TTCCTATTTAGAATCAGTACTGG + Intronic
1135747467 16:25029487-25029509 TTTCAATTTAGTGGGATTCCAGG + Intergenic
1143072378 17:4307439-4307461 TTCTCATTGAGAGGGAGCCCTGG + Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1146559309 17:33854567-33854589 TCCCTACTTTGAGGGAATCCTGG - Intronic
1147284601 17:39391827-39391849 TTCCTTTTTAGAGGTAGTTGCGG - Intronic
1147452426 17:40513995-40514017 TTCATATATGGAGGGATTCCTGG + Intergenic
1147759041 17:42785669-42785691 TTCCTTTACAGAGGGAGCCCTGG + Intronic
1151596203 17:75079316-75079338 TTCCTTATTTGGGGGAGTCCTGG + Intergenic
1151723930 17:75874035-75874057 TTCCTGTTGAGAGGGAGCCCTGG - Intergenic
1153216872 18:2828848-2828870 TTCCTGTTTAGAGAGTGTCGAGG + Intergenic
1153319091 18:3753903-3753925 TTGGTATTTGCAGGGAGTCCTGG - Intronic
1161367029 19:3885917-3885939 TTCCCACTTAGAGAGAGACCCGG - Intronic
1162483509 19:10943938-10943960 TTTTTTTTTAGAGGGAGTCTTGG - Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
929117383 2:38455972-38455994 TCCCTCTTAAGAGAGAGTCCTGG + Intergenic
930875688 2:56212931-56212953 TTCCTCTTTGGAGGGAGTAAGGG - Intronic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
940275537 2:151936750-151936772 TTCCTAATGAGAGGTGGTCCGGG - Intronic
945832967 2:214808974-214808996 TTCTAATTTAGAGGGTCTCCGGG + Intronic
946916624 2:224529597-224529619 TTCTTTTTGAGAGGGAGTCTCGG - Intronic
947197690 2:227584932-227584954 GTTCTCTTTAGAAGGAGTCCAGG - Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1172094084 20:32452248-32452270 TTCCTGTTTGGAGGGAGGCAGGG + Exonic
1173943960 20:46935167-46935189 TTGCTATGTAGAGTGAGTGCAGG + Intronic
1176687636 21:9865287-9865309 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1179458332 21:41515167-41515189 TTCCTAGGTAGAGGCAGTTCTGG + Intronic
1181077807 22:20393262-20393284 TTCCTACTGAGAGGTGGTCCGGG - Intergenic
1182404349 22:30111589-30111611 TTGGTATTCATAGGGAGTCCTGG + Intronic
1182523878 22:30903391-30903413 TTCCTATTGAGAGGGAGCCCTGG + Intronic
951297252 3:20953985-20954007 TTGTTTTTTAGACGGAGTCCGGG + Intergenic
953511896 3:43550087-43550109 TTCCTAATTGGAGGCAGCCCTGG + Intronic
959098400 3:101982682-101982704 TTCCCATTTACATGGGGTCCTGG - Intergenic
960857643 3:122119656-122119678 ATTCCACTTAGAGGGAGTCCTGG - Exonic
963529515 3:146456394-146456416 TTCCTATATAGGCAGAGTCCAGG - Intronic
963868631 3:150389446-150389468 AACCTATTTAGAAGTAGTCCAGG - Intergenic
967668891 3:192208022-192208044 TTGCTATTTAGAGGAACTCTGGG - Intronic
970359519 4:15294605-15294627 TTCCTGATTTGAGGGAGTTCAGG + Intergenic
972934690 4:44118955-44118977 TTACAATTTAGAGTAAGTCCTGG - Intergenic
974831312 4:67193040-67193062 ATCCTATTTGGAGGGAGGCATGG - Intergenic
977681075 4:99799113-99799135 TGCCTTGTTAGAGGGAGACCAGG + Intergenic
978101338 4:104844025-104844047 TTCCTATCTAGTGGTAGTCAGGG + Intergenic
980350988 4:131683103-131683125 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
982803088 4:159728762-159728784 TTCCTCTTGAGAGAGTGTCCAGG - Intergenic
986701254 5:10411342-10411364 TTCTTATTTATTGGGAGACCAGG + Exonic
986740674 5:10702532-10702554 TCCCTCTTTAGAGGGAGCTCAGG + Intronic
988987202 5:36632053-36632075 TTCCTATTTTGATAGAGTCATGG + Intronic
989722557 5:44547001-44547023 TTCCATTTAAAAGGGAGTCCTGG - Intergenic
991909122 5:71544004-71544026 TTCCACTTTAGAGGAAGTCTTGG - Intronic
997832395 5:137162147-137162169 TTCCTCTTGAGATGGAGTCTTGG + Intronic
998905034 5:146895788-146895810 TTCCTAATGAGGTGGAGTCCAGG - Intronic
1002349622 5:178574859-178574881 TTCCTATTGAGCAGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1004881584 6:20013718-20013740 CACCTATTGAGAGGGTGTCCAGG + Intergenic
1005744597 6:28824784-28824806 CTCCTATTCCGAGAGAGTCCAGG + Intergenic
1006739483 6:36297161-36297183 TTCCTACTTGGAGTGATTCCAGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1010466645 6:76174970-76174992 TTCCTCTCTAGAGGCAGTCTGGG - Intergenic
1011779817 6:90775295-90775317 TTGTTGTTTAGAGGGAGCCCAGG + Intergenic
1013455888 6:110329487-110329509 TTCCTTTTTAGAGGGGGTGGGGG + Intronic
1015736360 6:136404064-136404086 TTCCTCTTTAGAGACTGTCCAGG - Intronic
1018221374 6:161583467-161583489 TTCCTATTTAGGAGAAGTTCAGG + Intronic
1020387916 7:7627721-7627743 TGCCTATATAGAGAAAGTCCTGG + Intergenic
1021503203 7:21352420-21352442 TTCCTATTTAGAAGGATTGCAGG + Intergenic
1022136903 7:27457543-27457565 TTCCTATTTAGAGGGAGTCCTGG - Intergenic
1023220716 7:37918219-37918241 TTCTTATTTAGGGGAAGCCCAGG + Intronic
1023592442 7:41794235-41794257 TGCCTAATTAGAGGGAGTTTTGG + Intergenic
1024094723 7:45974575-45974597 TTCCTATTCATAGGGAGTCATGG + Intergenic
1024286869 7:47765444-47765466 TTTCCATTTGGTGGGAGTCCAGG + Intronic
1026926238 7:74195906-74195928 TTCCTATTTAGAGGGAGTCCTGG + Exonic
1027956838 7:84889183-84889205 TTTCTATTTAAAGTGAATCCAGG + Intergenic
1029819439 7:103131752-103131774 AACCTCCTTAGAGGGAGTCCAGG - Intronic
1032441492 7:131945890-131945912 TTCCTTTTTGGAGTGAGTCCTGG - Intergenic
1032724788 7:134580724-134580746 TGCCTCTTGAGAGGGAGTCAGGG - Intergenic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1034882354 7:154772322-154772344 TTCCTCTTTAGGGGGACTTCGGG - Intronic
1035944638 8:3948189-3948211 TTATTATTTAGACGGAGTCTTGG - Intronic
1041994674 8:64039404-64039426 TACCTATATAGAGAGAGTACAGG + Intergenic
1042251747 8:66762865-66762887 TTCCAATTTATAGGGACTGCAGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1054169668 9:61826766-61826788 TCCCTATGTTGAGGGAGCCCTGG + Intergenic
1054667870 9:67754049-67754071 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1056472744 9:86921575-86921597 TCCCTATTGATAAGGAGTCCTGG - Intergenic
1056686509 9:88767936-88767958 TTCATTTTTGGAAGGAGTCCTGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1187664047 X:21584447-21584469 TTTATATTTGGAGGAAGTCCAGG + Intronic
1189294811 X:39910624-39910646 TTCCCACCTAGAGGGAGGCCCGG + Intergenic
1189650682 X:43186039-43186061 TTGGTATTTAAAGGAAGTCCTGG - Intergenic
1190372666 X:49757994-49758016 TTCCTACTTAGAGGGCCACCTGG + Intergenic
1191234821 X:58125862-58125884 TTCCTAAATATAGGGAGACCAGG + Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1193658550 X:84227687-84227709 TTCCTATATATAGGCAGTCAAGG - Intergenic
1193809109 X:86030676-86030698 TCCCTCTGTAGAGGGAGTCATGG + Intronic
1197298073 X:124743857-124743879 CTCATCTTTAGAGGGAGTGCTGG + Intronic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201286286 Y:12381455-12381477 TTGTTTTTTAGAGGGAGTCTTGG + Intergenic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic