ID: 1026928513

View in Genome Browser
Species Human (GRCh38)
Location 7:74210143-74210165
Sequence GCTCCTGGCCCCACTGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 330}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026928500_1026928513 -7 Left 1026928500 7:74210127-74210149 CCCCCATCCCCCAGGAGCTCCTG 0: 1
1: 0
2: 7
3: 100
4: 771
Right 1026928513 7:74210143-74210165 GCTCCTGGCCCCACTGGGTGGGG 0: 1
1: 0
2: 3
3: 55
4: 330
1026928501_1026928513 -8 Left 1026928501 7:74210128-74210150 CCCCATCCCCCAGGAGCTCCTGG 0: 1
1: 1
2: 7
3: 79
4: 792
Right 1026928513 7:74210143-74210165 GCTCCTGGCCCCACTGGGTGGGG 0: 1
1: 0
2: 3
3: 55
4: 330
1026928493_1026928513 26 Left 1026928493 7:74210094-74210116 CCTTTCCCAGGGGTGCCTCAGTC 0: 1
1: 0
2: 1
3: 21
4: 211
Right 1026928513 7:74210143-74210165 GCTCCTGGCCCCACTGGGTGGGG 0: 1
1: 0
2: 3
3: 55
4: 330
1026928503_1026928513 -9 Left 1026928503 7:74210129-74210151 CCCATCCCCCAGGAGCTCCTGGC 0: 1
1: 0
2: 7
3: 50
4: 446
Right 1026928513 7:74210143-74210165 GCTCCTGGCCCCACTGGGTGGGG 0: 1
1: 0
2: 3
3: 55
4: 330
1026928498_1026928513 4 Left 1026928498 7:74210116-74210138 CCTCAGGCTGTCCCCCATCCCCC 0: 1
1: 0
2: 7
3: 69
4: 678
Right 1026928513 7:74210143-74210165 GCTCCTGGCCCCACTGGGTGGGG 0: 1
1: 0
2: 3
3: 55
4: 330
1026928504_1026928513 -10 Left 1026928504 7:74210130-74210152 CCATCCCCCAGGAGCTCCTGGCC 0: 1
1: 2
2: 10
3: 87
4: 672
Right 1026928513 7:74210143-74210165 GCTCCTGGCCCCACTGGGTGGGG 0: 1
1: 0
2: 3
3: 55
4: 330
1026928495_1026928513 20 Left 1026928495 7:74210100-74210122 CCAGGGGTGCCTCAGTCCTCAGG 0: 1
1: 0
2: 3
3: 30
4: 272
Right 1026928513 7:74210143-74210165 GCTCCTGGCCCCACTGGGTGGGG 0: 1
1: 0
2: 3
3: 55
4: 330
1026928497_1026928513 11 Left 1026928497 7:74210109-74210131 CCTCAGTCCTCAGGCTGTCCCCC 0: 1
1: 0
2: 4
3: 49
4: 479
Right 1026928513 7:74210143-74210165 GCTCCTGGCCCCACTGGGTGGGG 0: 1
1: 0
2: 3
3: 55
4: 330
1026928494_1026928513 21 Left 1026928494 7:74210099-74210121 CCCAGGGGTGCCTCAGTCCTCAG 0: 1
1: 0
2: 2
3: 23
4: 289
Right 1026928513 7:74210143-74210165 GCTCCTGGCCCCACTGGGTGGGG 0: 1
1: 0
2: 3
3: 55
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026928513 Original CRISPR GCTCCTGGCCCCACTGGGTG GGG Intronic
900203839 1:1422697-1422719 CCTCCGTGCCCCACTGTGTGTGG - Intergenic
900324985 1:2104328-2104350 ACTCCTAGCCCCACGGGCTGAGG + Intronic
900331632 1:2137670-2137692 GCTCCGGGCAGCACAGGGTGTGG + Intronic
900480412 1:2895470-2895492 GCTCCTGACCGCAATGTGTGGGG + Intergenic
900592133 1:3464851-3464873 GCTCCTGCCCAGACTGGGAGTGG + Intronic
900622080 1:3592132-3592154 TCTCCTGGGGCCACTGTGTGAGG - Intronic
900644854 1:3704396-3704418 GCCACTGGCCACACAGGGTGGGG - Intronic
900881318 1:5383218-5383240 TCCCCTGGCCCCACTGGGAATGG + Intergenic
900977910 1:6028586-6028608 GCTGGTGGCCGCTCTGGGTGCGG + Intronic
901815162 1:11789624-11789646 CTTCCTGGCCTCACTGGCTGGGG - Exonic
902942920 1:19813595-19813617 GCAGCTGGCCCCACTGTATGTGG + Intergenic
904034515 1:27551588-27551610 GCTGTTGGCCAAACTGGGTGAGG + Exonic
904365438 1:30008131-30008153 GCTGCCGGTGCCACTGGGTGGGG - Intergenic
904925138 1:34041654-34041676 GTTCCTCACCCCACAGGGTGAGG - Intronic
907394244 1:54178369-54178391 CCTCCTGTCCCCTCTGGGTTGGG - Intronic
907433824 1:54431078-54431100 GCTCCTGTCCCCACTGGATAAGG + Intergenic
907713785 1:56908951-56908973 CCTCCTTGCCCCACTGTGGGTGG - Intronic
908824311 1:68118583-68118605 GCACCTGGCCCGGCTGGTTGTGG + Intronic
909453959 1:75829483-75829505 GGTCATGGCCCCACTTGGGGAGG - Intronic
912520809 1:110243474-110243496 GCTCCTGGCCCCAGCAGGTCCGG - Intronic
914919484 1:151837975-151837997 GCTGCTGCCCCCGCTGGGTGGGG - Exonic
915105621 1:153533603-153533625 TCTTCTGTCCCCACTGGGTGGGG - Intergenic
915275852 1:154787712-154787734 GCTTCTGACTCCACGGGGTGTGG - Intronic
915280377 1:154818376-154818398 GCTGCTGGCCCCCCTGGGAGAGG - Intronic
918248470 1:182681142-182681164 ACACCTCTCCCCACTGGGTGTGG - Intronic
919728903 1:200900637-200900659 CCTCCTGACCCCAAAGGGTGGGG - Intronic
920342597 1:205284822-205284844 GCTCCTGCTCCCTCTGGGGGAGG - Intergenic
920374419 1:205499849-205499871 GCTGCAGGCCACACTGGCTGGGG - Intergenic
920390005 1:205593922-205593944 GCTTCTGGCTCCTCTGAGTGGGG + Intronic
922144876 1:222932290-222932312 GGTCCTGGCCCCAGAGGTTGAGG - Intronic
922170836 1:223153142-223153164 GTGCCTGGCCACACTGGGTGAGG + Intergenic
922764905 1:228151664-228151686 GCAGTAGGCCCCACTGGGTGTGG - Intronic
923291365 1:232549160-232549182 GCTCCTGTCACCTCTGGTTGGGG - Intronic
923355404 1:233150084-233150106 GGTCCTGGCCCCGCTGGCTGTGG - Intronic
924456070 1:244219743-244219765 GCTCGTGGCAGCAATGGGTGGGG + Intergenic
1063537654 10:6900828-6900850 GTCCCTGGCCCTACTGTGTGGGG + Intergenic
1067564630 10:47327658-47327680 CCTCCAGACCCCACTGGGTTGGG + Intergenic
1068143072 10:53029705-53029727 GCTCCTGACCCCAAAGGGTCGGG + Intergenic
1069712986 10:70501561-70501583 GACCCTGACCCCACGGGGTGAGG - Intronic
1069934524 10:71906092-71906114 GCTCCTCCCCGCACTGGCTGTGG - Intergenic
1069960178 10:72074919-72074941 GCTCCTGGGCCCAGGGGCTGCGG - Intronic
1070153624 10:73820025-73820047 GCTCCAGGCCCCTGTGAGTGAGG - Intronic
1070965603 10:80528510-80528532 GCTCCTTGTCACACTGGTTGGGG + Exonic
1071575896 10:86726088-86726110 CCCGCTGCCCCCACTGGGTGCGG + Intronic
1072219867 10:93318002-93318024 GCTCCAAGCACCACAGGGTGTGG + Intronic
1072735356 10:97875560-97875582 GTTCCTGGCCCCTGTGGCTGGGG + Intronic
1073012269 10:100370732-100370754 ACTACTGGCTCTACTGGGTGTGG + Intergenic
1073111614 10:101066232-101066254 GATCCTGGCGCCACTGCGGGAGG + Intronic
1073421170 10:103424908-103424930 ACTCATGGCCCCACTGGGCAGGG - Intronic
1075211025 10:120491123-120491145 GCTGCTGGCCCTGCTGGGTGAGG + Intronic
1075663751 10:124216384-124216406 GCTCCTGCCCACACTGGCAGTGG - Intergenic
1075783723 10:125033827-125033849 GCTCCGGGCCACACTGTGGGAGG + Intronic
1075919484 10:126198424-126198446 GCTCCTGGAGCCATTGGGAGGGG + Intronic
1076413949 10:130271625-130271647 GCTTCTGTCCACACGGGGTGGGG - Intergenic
1076798976 10:132811968-132811990 GCTGATGGCCCCACTGTGTGGGG - Intronic
1077030235 11:462215-462237 GCTCCTGGCCCCTCTGGGTCTGG - Intronic
1077150864 11:1072587-1072609 GCTCCTGGCTCAACTGTGTCCGG + Intergenic
1077231511 11:1459962-1459984 GCTGCTGGCCCCACTGCATGAGG - Intronic
1077501675 11:2912291-2912313 GCACCTGGCCCCACTGCCTTCGG - Intronic
1080033819 11:27689888-27689910 GCTCCAGGCCCCAGTGTGTGTGG + Intronic
1080577085 11:33609697-33609719 CCTGCCGGCCCCACTGGGTCAGG + Intronic
1080878453 11:36297777-36297799 GCTGCAGGCCCCACTGGAGGAGG - Intronic
1081538258 11:44011253-44011275 GTTTCTGGCCTCACTGGCTGGGG - Intergenic
1083155719 11:60821756-60821778 GCGCCTGCCCTCACTGGCTGGGG + Intergenic
1084477004 11:69394764-69394786 GCTCCTGTCCCCACGGCGGGGGG - Intergenic
1084949529 11:72657126-72657148 GCCCCTGGCCCAGCTGGGTCAGG + Intronic
1085392000 11:76186995-76187017 GCCCCTGGCCCCAGTTGCTGAGG + Exonic
1085451995 11:76639740-76639762 ACTCCAGCCCCCACTGGGTAAGG + Intergenic
1087159684 11:94936511-94936533 GCTCCTGCTCCCACTGGGCGTGG + Intergenic
1088808645 11:113374270-113374292 GCTCCTAGCCCATCTGGGGGAGG - Intronic
1089071225 11:115701177-115701199 ATTCCTGGCTCCAGTGGGTGGGG + Intergenic
1089290579 11:117435701-117435723 CATCCTGGCCACACTGGGGGTGG - Exonic
1089602386 11:119623865-119623887 CTTCCTGGGCCCACTGGGAGGGG - Intronic
1089605615 11:119639727-119639749 GTTCCTGGTCCCCCAGGGTGGGG + Intronic
1091295361 11:134470388-134470410 GCTCCTGGAGACAGTGGGTGGGG - Intergenic
1091816933 12:3445922-3445944 CCTCCTGGCCCCATTGGTAGGGG + Intronic
1091917369 12:4279452-4279474 GCTGTTTGCCCCACTGGGCGCGG + Intronic
1092015802 12:5157107-5157129 GCTCCTGGCCCTACTGCCCGTGG + Intergenic
1092154678 12:6274516-6274538 GCTCCTTGTCCCACTGGCAGGGG - Intergenic
1092159601 12:6308930-6308952 GCTCCTGGCCCAGCTGGTGGTGG - Intergenic
1096554525 12:52395216-52395238 GCTCAGGGCCCCACACGGTGTGG + Intronic
1096769986 12:53928909-53928931 TCTCCAGGCTCCACTGTGTGAGG + Intergenic
1097405260 12:59181583-59181605 GCTCCTGGCCCAATTAGCTGTGG - Intergenic
1101745778 12:107540376-107540398 GTGCCTGCCCACACTGGGTGAGG + Intronic
1102164789 12:110797585-110797607 CCTCCAGGCCCCACTGGGTATGG - Intergenic
1102230821 12:111261065-111261087 ACACCCGGCCCCACTGGCTGGGG + Intronic
1102511344 12:113417668-113417690 GCTTCTAGCCTCACTGGCTGCGG - Intronic
1102511349 12:113417701-113417723 GCTTCTAGCCTCACTGGCTGCGG - Intronic
1102646416 12:114406698-114406720 TCTGGTGGCCCCACTGGGTGGGG - Intronic
1102980125 12:117234712-117234734 GCTCCTGGCTCCCGTTGGTGTGG + Exonic
1103480183 12:121245560-121245582 GTTCCAGACCCCTCTGGGTGGGG - Intronic
1103833337 12:123798367-123798389 GCTCCTGCTCCCACTGTGTGAGG - Intronic
1105378399 13:19864369-19864391 AGTCCTGGCCCCACGGGGTTTGG - Intergenic
1106714400 13:32373215-32373237 ACTCCTAGCCTCGCTGGGTGGGG + Intronic
1107831148 13:44374323-44374345 GGTCGTGGCCCCTCTGGGAGTGG + Intronic
1112005038 13:95246350-95246372 GCACCTGGGCCCACTGGGAGGGG + Intronic
1113666224 13:112143548-112143570 GCTCGTGGCCTCACTTAGTGAGG + Intergenic
1113716890 13:112516373-112516395 CCTCCAGCCCCCACTGGGTGCGG - Intronic
1113891044 13:113735820-113735842 GCCCCTGGCCCCACTGGGGAGGG + Exonic
1113896125 13:113765684-113765706 GCCCCCTCCCCCACTGGGTGTGG + Intronic
1113970011 13:114181482-114181504 GCTACAGGCCCCACTGAATGAGG + Intergenic
1114219350 14:20682991-20683013 GCTGTTGGCCTCACTGGGCGCGG - Intergenic
1114266031 14:21073116-21073138 ACACCTGGCCCAACAGGGTGGGG - Exonic
1114674260 14:24430253-24430275 GCTCCTGGCCCGACGGAGAGGGG + Intronic
1115202999 14:30874187-30874209 GCTCCAGGCCTCGCTGGGTGGGG + Intergenic
1118483841 14:66195616-66195638 GCACCTGGCCTCATTGTGTGGGG + Intergenic
1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG + Intronic
1122033589 14:98931619-98931641 GCCCCTGGCCTGGCTGGGTGTGG - Intergenic
1122688441 14:103520846-103520868 GCTCCTACCCCCACTGTGGGGGG - Intronic
1122899610 14:104776925-104776947 GGTCCTAGCCCCACTCTGTGAGG - Intronic
1122902275 14:104786847-104786869 GCCCCTGGCCCCAGTCTGTGGGG + Intronic
1128237452 15:66077912-66077934 CTTCCTGGCCCCTCTGGATGTGG - Intronic
1128978674 15:72170730-72170752 GCCCCTGGGCCCACTTGGTTGGG - Intronic
1129188022 15:73922481-73922503 GCTCCTGTCTCCACTGGCTCTGG + Intergenic
1129297700 15:74608952-74608974 GCTGCTAGCAGCACTGGGTGTGG - Intronic
1132149046 15:99446948-99446970 ACTCCTGCCCCCGCTGGGTAAGG - Intergenic
1132243654 15:100278762-100278784 AATCCTGGGCCCACTGGGTGTGG - Intronic
1132405807 15:101541365-101541387 GCTCCTGGCCCCTCCTGGAGGGG + Intergenic
1132657357 16:1046851-1046873 GCTCAGAGCCCCACTGTGTGAGG + Intergenic
1132789121 16:1675303-1675325 GCTCCAGGCCACACTGGATGTGG - Exonic
1133171449 16:3984836-3984858 TCTCCTGGCAGCCCTGGGTGCGG + Intronic
1133234757 16:4382632-4382654 GCTCCTGGCCGCGCTGGCTGCGG + Exonic
1134494840 16:14724704-14724726 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134500223 16:14763824-14763846 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134526765 16:14950436-14950458 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134545641 16:15105912-15105934 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134580356 16:15365226-15365248 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134714342 16:16348913-16348935 GATGGGGGCCCCACTGGGTGGGG - Intergenic
1134722217 16:16392277-16392299 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134945210 16:18319592-18319614 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134952474 16:18359745-18359767 GATGGGGGCCCCACTGGGTGGGG + Intergenic
1135864875 16:26092063-26092085 TCTCCTGGCCCCACGGTGGGAGG + Intronic
1136063399 16:27742323-27742345 TTTCCTTGCCACACTGGGTGGGG - Intronic
1136506955 16:30710558-30710580 AATCCTGGCCCCACTGCCTGGGG - Intronic
1137714840 16:50592314-50592336 TGTCCTGGGCCCACTGGGGGTGG + Intronic
1138344391 16:56311329-56311351 CCCCCTGCCCCCACTGGGTTAGG + Intronic
1138452787 16:57103706-57103728 GCTGCTGGGCCGGCTGGGTGGGG - Intronic
1141538592 16:84700343-84700365 GCTCCGGGCCCCGCTTGGGGAGG + Intronic
1141545091 16:84761521-84761543 CCTTGTGGCCCCACTGGGAGAGG - Intronic
1141844471 16:86597984-86598006 GCTCCTTGCCCCAAAGGCTGTGG - Intergenic
1142089185 16:88200954-88200976 GCAGCAGGCCCCACTGTGTGTGG + Intergenic
1142104760 16:88296265-88296287 GCTTCTGTCCCCACTGGGGATGG + Intergenic
1142132231 16:88436341-88436363 GCTCCAGGGCCCACAGGCTGAGG - Exonic
1142200633 16:88759671-88759693 CCTCATGGCCCCTCTGGGTCTGG - Intronic
1142282196 16:89154470-89154492 GCCCCTGGCCCCACGTGCTGAGG + Exonic
1142798300 17:2326715-2326737 ACTCCTGGGCCCACTGGCTCAGG + Intronic
1143201822 17:5118556-5118578 GCCCCTAGCCCCATTGCGTGGGG + Intronic
1143527711 17:7482104-7482126 GCTGGTGGCCCTGCTGGGTGGGG + Exonic
1143633021 17:8149525-8149547 GCTCCTGGCTCCCCAGGATGTGG - Exonic
1143944401 17:10577665-10577687 GCACCTGGCCCCAAAGGTTGTGG + Intergenic
1144025749 17:11274492-11274514 GCTCCTGGCCCCCAGGGATGTGG + Intronic
1145243080 17:21251032-21251054 CTTCCAGGCCCCACTGGGTTTGG - Intronic
1146058307 17:29591930-29591952 GGGCCTGGCACCACAGGGTGTGG + Intronic
1146731047 17:35194166-35194188 GCTGGTGGCCCTGCTGGGTGGGG - Exonic
1147038952 17:37702393-37702415 GCTTCTGGCTCTCCTGGGTGGGG + Intronic
1147325314 17:39667150-39667172 GTTCCTGGCCCCGCTTGATGTGG - Intergenic
1147458559 17:40553995-40554017 GCTCTTGGCTCCACTGGGATGGG - Exonic
1147658715 17:42105588-42105610 GCTCCTTGCCCCTCTGCCTGGGG + Intronic
1150281710 17:63932738-63932760 GCTCCTCTTCCCGCTGGGTGAGG - Intergenic
1150462778 17:65366369-65366391 GCTCCTCTCCCAACTGGGTAGGG - Intergenic
1152323769 17:79623909-79623931 GCTGCTGGCTCCGCAGGGTGAGG + Intergenic
1152469162 17:80481429-80481451 GCCCCTGGACCCACAGGGTTGGG + Intergenic
1152527046 17:80894266-80894288 GCTCCTTGTCCCAGTGGGTGAGG + Intronic
1152798768 17:82321614-82321636 GCTCCTGGCCCCACCGCCAGGGG - Exonic
1153015627 18:580282-580304 GCTCCAGGCCCCAGCGGGCGTGG + Intergenic
1153278866 18:3395331-3395353 GCTCCAGGCCTCCATGGGTGGGG - Intergenic
1154115454 18:11609715-11609737 GCTGGTGGCCCTGCTGGGTGGGG + Intergenic
1154384497 18:13880763-13880785 GCCCCTTGCCTCACTGTGTGGGG - Intergenic
1155177773 18:23315801-23315823 GCTCCTGGACCAACTGACTGGGG + Intronic
1157494137 18:48143135-48143157 GCTCCTGGCCCCTGAGGGTGGGG - Intronic
1158407814 18:57175899-57175921 ACTCCTGGCCCCAGTGGGTTGGG - Intergenic
1158511648 18:58095605-58095627 GCCCATGGCCCCAATGGGCGAGG - Intronic
1158536824 18:58315811-58315833 GCTCCTGGTCTCCCGGGGTGTGG + Intronic
1160225812 18:77009809-77009831 ACCCCTGGCCCCGATGGGTGAGG + Intronic
1160354632 18:78216536-78216558 GATCCTGTCCCCACTGGGCCAGG + Intergenic
1160715856 19:576238-576260 TCTCCTAGCACCCCTGGGTGAGG + Intronic
1160895406 19:1399954-1399976 GCGCCTGGCATCACTAGGTGGGG + Intronic
1160995469 19:1880234-1880256 GCTTCTGGCCCCCTTGGGAGGGG - Intronic
1161079937 19:2305655-2305677 ACTCCTGCCCCCTCTGGGTTTGG - Intronic
1161138556 19:2634967-2634989 GCTTCTTGCCTCACTGAGTGCGG - Intronic
1161179962 19:2873606-2873628 GCACCTGGCCTCAGTAGGTGAGG + Exonic
1161261409 19:3339876-3339898 CCTCTTTGCACCACTGGGTGGGG - Intergenic
1161353261 19:3805260-3805282 ACTGCTGGCCCCCCTGGCTGTGG + Exonic
1161397545 19:4052531-4052553 GTTCCTGTCCCCACGGGGTGGGG + Intronic
1161420480 19:4173749-4173771 GGTCCTCGCCCCCCTGGGTCAGG - Intergenic
1161422615 19:4184225-4184247 GCTCGTGGCCCAGCTGGGAGTGG + Intronic
1161851812 19:6741033-6741055 GGTCCAGCCCCCACTGCGTGTGG - Exonic
1162403157 19:10458090-10458112 GCTCCTGGCCCAAGTGGGTGGGG + Exonic
1162566529 19:11448013-11448035 ACTCCTGGCCCCACTCGCTCAGG + Intronic
1163170489 19:15527615-15527637 GCTCCTGGGCCCACGGGGGCTGG + Intronic
1163710050 19:18841001-18841023 GCTCCTGGCGGCCCTGGGAGAGG + Intronic
1163827780 19:19533206-19533228 CCTCCTGGCCCCTCGAGGTGTGG - Intronic
1166831927 19:45644508-45644530 GCAGCTGGCCTCTCTGGGTGGGG - Intronic
1167564986 19:50250529-50250551 ACTCCTGGCCCTGCTGGATGAGG + Exonic
1167966181 19:53149235-53149257 GAACCTGGCCTCCCTGGGTGAGG - Exonic
1168549974 19:57284661-57284683 GCTTCTGGTCGCACTGGGTAAGG + Exonic
925785996 2:7431671-7431693 GAACCTGGACACACTGGGTGGGG + Intergenic
926018360 2:9474176-9474198 GCTCCAGGCCCCCCTGGAAGAGG - Intronic
926727074 2:16006838-16006860 GCACTTGGCCACAGTGGGTGTGG - Intergenic
927138779 2:20115717-20115739 GGTCCTTGCCCCACTGATTGAGG - Intergenic
927192092 2:20523924-20523946 TCTCCTGGCCCCAGTGGGTCTGG - Intergenic
927798967 2:26079275-26079297 GCTCCTACCCCCACTCCGTGAGG - Intronic
927886853 2:26724103-26724125 GCTCCAGGGCCCCCTGGGAGTGG + Intronic
928080763 2:28310339-28310361 TCTCCTGGCTCCCCTGGGGGAGG + Intronic
930617380 2:53607703-53607725 GTTCCAGGGCCCACTGGGTGGGG - Intronic
934704971 2:96470886-96470908 GCTCTGGGCCACCCTGGGTGCGG - Intergenic
937333386 2:121045736-121045758 GCTCAGGGCCCCACTGCATGGGG + Intergenic
938071790 2:128312269-128312291 GCTCCTGGCCCTCCAGGCTGAGG + Intronic
941844623 2:170120797-170120819 GCTGCTGGCCCCACAGAGTGTGG - Intergenic
942228386 2:173836817-173836839 GCTCCAGTCCCCCCTGGGTTGGG + Intergenic
945676247 2:212858663-212858685 GCTCCTGGCCATGCTGGGTGTGG + Intergenic
946230258 2:218286894-218286916 GCTCCTGCGCCTGCTGGGTGGGG - Intronic
946827327 2:223692183-223692205 GCTACTGGCCCCGCTCTGTGGGG - Intergenic
947909865 2:233793874-233793896 CCTCCCGGCCCCACAGGCTGGGG - Intronic
948264143 2:236625225-236625247 GCTCCTGGCCCCATTCCATGAGG - Intergenic
948268657 2:236657073-236657095 GCACCAGGCCACAGTGGGTGGGG - Intergenic
948363269 2:237437558-237437580 GCTCCTGTCCTCACTGGGCAAGG - Intergenic
948389685 2:237602993-237603015 GCACCAGATCCCACTGGGTGGGG - Intergenic
948425559 2:237884907-237884929 GCTCCAGGCCCCAGGGAGTGGGG + Intronic
948717065 2:239871905-239871927 GCACCAGGCCCCAGTGGGTGGGG + Intergenic
948724178 2:239921762-239921784 GCTCCAGTTCCCTCTGGGTGAGG + Intronic
948908164 2:240989680-240989702 GGTCCTGGAGCCGCTGGGTGTGG - Intronic
1171207998 20:23296082-23296104 GCTCCTGACCCCCATGTGTGTGG + Intergenic
1171767333 20:29297459-29297481 GTTCCTGCCCCCACAGCGTGGGG + Intergenic
1172842278 20:37909170-37909192 GCTGCTCGCCCTCCTGGGTGTGG - Intronic
1173174596 20:40754789-40754811 GCTCCTGGCCCTGCTGGGGAGGG - Intergenic
1173730561 20:45325502-45325524 CCTCCTGACCCCAGTGGCTGCGG - Exonic
1173846673 20:46192917-46192939 CCTCCTGCTCCCACTGGGGGGGG - Intronic
1173893757 20:46534167-46534189 GCTCCTGCCCCAACTTGGAGGGG - Intergenic
1174343581 20:49913692-49913714 TCTCCTAGCCCCATTCGGTGTGG - Exonic
1174588637 20:51627724-51627746 GCTCCTGACCTCACTGGGGAAGG + Intronic
1174979580 20:55378414-55378436 GGTCCTGGCCCCTGTGGGTTTGG + Intergenic
1175069691 20:56322781-56322803 GCTCCAGGCACCACTGGGGCTGG + Intergenic
1175285056 20:57832315-57832337 GCTCCTGGCCTCACTCACTGTGG + Intergenic
1175799991 20:61796115-61796137 GCCAGTGGCCCCACAGGGTGAGG - Intronic
1175873786 20:62220171-62220193 GCTGCCGGCCCCACTGGGCTCGG - Exonic
1176200795 20:63859449-63859471 GCTCCTTTCCCCACAGGGTCAGG + Intergenic
1176308051 21:5134674-5134696 GCTCCTGGCTCCTCTGTGTGGGG + Intronic
1177250371 21:18583988-18584010 GCTCCAGGCGGCACAGGGTGGGG - Intergenic
1177364597 21:20117568-20117590 ACTTCTGGCACCACTGGCTGTGG + Intergenic
1178362717 21:31962929-31962951 GCTCTGGGCCCTACTGGGTCAGG - Intronic
1179448341 21:41449737-41449759 GCTTCTGTCCCCACGGGGTTGGG + Intronic
1179849009 21:44127358-44127380 GCTCCTGGCTCCTCTGTGTGGGG - Intronic
1180171901 21:46063939-46063961 ACTTCTGGCCTCTCTGGGTGGGG - Intergenic
1180707133 22:17816917-17816939 GCTCCTGGCTCCCCAGGATGGGG - Intronic
1180842910 22:18967592-18967614 GCCCCTGGCCTCACTGGAGGGGG + Intergenic
1181115988 22:20632835-20632857 GCTCCTGGCTGCTGTGGGTGGGG - Intergenic
1181433295 22:22895709-22895731 GCTCCAGGCTCCCGTGGGTGGGG - Exonic
1181436818 22:22915947-22915969 GCTCCAGGCCCCTGTGGGTGGGG - Intergenic
1181437659 22:22919873-22919895 GCTCCAGGCCCCTGTGGGTGGGG - Intergenic
1181438307 22:22922928-22922950 GCTCCAGGCCCCTGTGGGTGGGG - Intergenic
1181472749 22:23150965-23150987 GCTCCTGCCACCACTGGCAGAGG + Intronic
1181540981 22:23573229-23573251 GCTCCAGGCCCCTTTGGGTGGGG + Exonic
1181550888 22:23638588-23638610 GCTCCAGGCCCCTGTGGGTGGGG + Intergenic
1181562785 22:23715369-23715391 ACTCCTGGCCCCACTGGCCCAGG - Intergenic
1181635486 22:24172460-24172482 GTACCAGGCCCTACTGGGTGTGG + Intronic
1181797398 22:25320101-25320123 GCTCCAGGCCCCTGTGGGTGGGG - Intergenic
1181829222 22:25546088-25546110 GCTGCTGGCCCCTCTGTGTCTGG + Intergenic
1182091154 22:27595754-27595776 GCTCCTGGGCCCACAGTCTGAGG - Intergenic
1182459893 22:30476156-30476178 CCTCCTGACCCCACTGGCTGGGG - Intergenic
1182696093 22:32200249-32200271 GCTCCAGGCCCCCATGGGTGGGG - Intronic
1182716006 22:32356636-32356658 GCTCCAGGCCCCCATGGGTGGGG + Intronic
1183947012 22:41332307-41332329 GCCCCTGGACCCACTGCCTGAGG - Intronic
1185110468 22:48897617-48897639 GGTCCTGGCCACTTTGGGTGAGG + Intergenic
1185116530 22:48941299-48941321 GCTCCTGGGGGCAGTGGGTGGGG + Intergenic
1185241717 22:49750533-49750555 CCTCCTGGCCGCACTGGGCCTGG - Intergenic
950418692 3:12883810-12883832 GTTCCTGGTCTCACTGGCTGAGG - Intergenic
950511924 3:13434633-13434655 GCTCCTGAACCCACTAGGAGTGG - Intergenic
951179441 3:19641852-19641874 GCTCCTGGCCACAGAGTGTGGGG - Intergenic
953055112 3:39381733-39381755 GCTCTTGGCCACTCTGGGTGTGG - Intergenic
953868922 3:46609453-46609475 GTTCCTGCCCCCACTGGGGGAGG + Intronic
954654624 3:52186362-52186384 GCTCCAGGCCCCCTTGGGAGGGG - Intergenic
961919628 3:130412390-130412412 GCTGCTAACCACACTGGGTGAGG + Intronic
964524721 3:157606400-157606422 GCTCCAGGCCCCACTGCCAGGGG + Intronic
966594760 3:181715671-181715693 GTTCCTGGTCCCCGTGGGTGGGG - Intergenic
966660402 3:182408285-182408307 GGTCAAGGCCCCACTGGGTATGG - Intergenic
966853877 3:184180968-184180990 GCTCATGTCCCCACAAGGTGAGG + Exonic
966912259 3:184566152-184566174 GATGCTGGCCACACTGGGTCTGG - Intronic
966958397 3:184908591-184908613 GCCTCTGGCCCCATTGTGTGGGG + Intronic
967190105 3:186977540-186977562 TCTCCTGGGCCCACTGGGTCAGG + Intronic
967812854 3:193775060-193775082 TCTCCTGGCCCGACTGTGGGAGG + Intergenic
968385891 4:137099-137121 GCTCCTGCTCCCACTATGTGAGG + Intronic
968540226 4:1164578-1164600 GCTGCTGGGCCTACAGGGTGAGG - Intergenic
968809693 4:2794297-2794319 GCTCCTGCCCTCACTGGCTCAGG + Intronic
968915184 4:3494161-3494183 CCTGCTGACCCCACTGGGAGAGG + Exonic
969202702 4:5618406-5618428 GCTGCTGGCCCTACAGGGTCTGG - Intronic
969339300 4:6530289-6530311 GCTCCTCTCCTCCCTGGGTGGGG - Intronic
969348625 4:6584972-6584994 GCTCCTGGCTCCTCTCAGTGCGG + Intronic
969573219 4:8022283-8022305 GATCCTCGGCCCACTGAGTGGGG - Intronic
978383191 4:108152421-108152443 GTGCCTTGCCCCACTGGCTGTGG - Intronic
979441064 4:120749935-120749957 TTTCCTGGCCCTACTGGCTGTGG - Intronic
979688495 4:123537708-123537730 TCTCATGGCCCCAAAGGGTGAGG - Intergenic
981179028 4:141716805-141716827 CATCCTGGGCACACTGGGTGGGG - Intronic
982060411 4:151598969-151598991 GCCCCCAGCCCCACTGGGGGAGG + Intronic
985647934 5:1093830-1093852 GCTCCAGGCCTCACTGAGTGGGG + Intronic
986736401 5:10671071-10671093 GCCACTGGTCCCACTGGGTGAGG + Intergenic
990510879 5:56488021-56488043 GCTCCTGGTCCCAAGGGCTGAGG + Intergenic
991030589 5:62078196-62078218 GCTGCTGGCACCACTGAGTGGGG - Intergenic
994722948 5:103401598-103401620 GCTTCTGTCCCCACTGAGTGAGG - Intergenic
994777237 5:104049932-104049954 GCCCCTGGCCCCATTGCGTGGGG - Intergenic
998210613 5:140194532-140194554 GGTCCTGGACCCATTGGTTGTGG - Exonic
998621311 5:143796965-143796987 TCTCCTTGCCCCACAGGATGAGG + Intergenic
1000276989 5:159746738-159746760 GCTCCTGGCCCCTCTGGGAGTGG + Intergenic
1000980457 5:167811396-167811418 GCTCCTGACCCCACCATGTGAGG + Intronic
1001023565 5:168204505-168204527 GCTGCTGGCCCCAGTGGCTCTGG + Exonic
1002577138 5:180180559-180180581 GCTCCTGGCACCTCTGGGCAGGG - Intronic
1006878481 6:37318686-37318708 CCTCCTGGAACCCCTGGGTGGGG + Intronic
1012919799 6:105209642-105209664 ACCTCTGGCCCCACTGGGTTGGG + Intergenic
1014248752 6:119094906-119094928 TCCCCTGGCACCACTGGCTGGGG + Intronic
1017250234 6:152272347-152272369 TCACCAGTCCCCACTGGGTGGGG + Intronic
1017653217 6:156601812-156601834 GGTCCTGCGCCAACTGGGTGCGG + Intergenic
1019210075 6:170397803-170397825 GCTGTTGGCCCCTCTAGGTGAGG + Intronic
1019261535 7:84557-84579 TCTCCTGGCTTCTCTGGGTGAGG - Intergenic
1019346576 7:533724-533746 GCTCCTGTCCCACCAGGGTGGGG - Intergenic
1019427545 7:984592-984614 GCTACGGGGCCTACTGGGTGTGG + Intronic
1020279437 7:6642903-6642925 GCTCCTGGCCCTGCAGGCTGGGG + Intronic
1020369641 7:7417875-7417897 CCTCCTGGCCCCCCTGGCTATGG - Exonic
1021660587 7:22915101-22915123 CCTTCTGGCCCCTCTGGGTCTGG - Intergenic
1021835625 7:24670705-24670727 GCTCCTGGCAGCAGGGGGTGAGG - Intronic
1023557464 7:41438046-41438068 CCTCCTGGCCTCCCTGGGTGTGG - Intergenic
1023821027 7:43980573-43980595 TGTCCTGTCCCCGCTGGGTGCGG + Intergenic
1023829608 7:44031081-44031103 GCTGCTGCCCCCAGAGGGTGGGG - Intergenic
1025227641 7:57178563-57178585 ACTCCTGGCCCCACTGGCCCAGG - Intergenic
1025929070 7:65980583-65980605 ACTCCTGGCCCCACTGGCCCAGG - Intronic
1026338179 7:69412646-69412668 GCTCATGGACACAGTGGGTGAGG + Intergenic
1026928513 7:74210143-74210165 GCTCCTGGCCCCACTGGGTGGGG + Intronic
1027328271 7:77065001-77065023 TGTCCTGTCCCCGCTGGGTGCGG - Intergenic
1029495128 7:100892462-100892484 TCTCCTGGCCCCTGTGGATGGGG - Exonic
1029739916 7:102485339-102485361 GCTGCTGCCCCCAGAGGGTGGGG - Intronic
1029775851 7:102683579-102683601 GCTGCTGCCCCCAGAGGGTGGGG - Intergenic
1032019095 7:128396683-128396705 GCTGCTGTCACCACTGGGGGTGG + Exonic
1034279735 7:149844720-149844742 GCTGGTGGCACCACTGGGTATGG + Exonic
1036563144 8:9914355-9914377 GGTCTTGACCCCACTGTGTGTGG + Intergenic
1036658355 8:10691978-10692000 GCTCCTGGCCCCTCTGCTTGGGG + Intronic
1036737488 8:11331226-11331248 GCTGGTGGCCCTGCTGGGTGGGG + Exonic
1037907420 8:22723772-22723794 GCTCCAGGCCACCCTGGGAGTGG - Intronic
1037939625 8:22941826-22941848 GCTCCAGGCCACACTTGTTGGGG - Intronic
1038286044 8:26207212-26207234 GTCCCTGGCCCCATTGTGTGAGG - Intergenic
1038425869 8:27463342-27463364 ACACCATGCCCCACTGGGTGCGG - Exonic
1038520378 8:28227151-28227173 GCCCCTGGCCGGACTGGGTGTGG - Intergenic
1038554048 8:28494310-28494332 GCGCCTGGCTCCAAGGGGTGGGG - Exonic
1039469154 8:37802890-37802912 GATCTTGGACCCACTGGGGGCGG - Intronic
1039616137 8:38956379-38956401 GCTCCTTGCCTCACTGTGCGGGG - Intronic
1039715045 8:40099064-40099086 ACTCCCGTCCCCACTGAGTGGGG - Intergenic
1042798927 8:72696467-72696489 GCTCATGGCACCACTGGAAGTGG + Intronic
1042953058 8:74220705-74220727 GCTCCTCTCTCCACTGAGTGTGG - Intergenic
1045092967 8:98766109-98766131 TTTCCTGGCTCCACTGGCTGAGG + Intronic
1045720817 8:105108864-105108886 GTGCCTGCCCACACTGGGTGAGG - Intronic
1045906569 8:107353327-107353349 GGTCATGGCCCCTCTGTGTGTGG + Intronic
1047581708 8:126223426-126223448 GCCCCTGGCCCCATTGTATGGGG + Intergenic
1048042165 8:130741478-130741500 GCTTCTGGCCCCACTGAATGTGG - Intergenic
1048286472 8:133145747-133145769 GCTCCTGGCCCCTGAGGCTGTGG + Intergenic
1049044672 8:140140021-140140043 GGTCCTGCCTTCACTGGGTGTGG - Intronic
1049454971 8:142682148-142682170 GCTGCAGCCCACACTGGGTGTGG + Exonic
1049678421 8:143903966-143903988 GCTGCGGGCCCTGCTGGGTGAGG - Intergenic
1049819036 8:144622994-144623016 AGTCCTGGCCCCACTCGGTCAGG + Intergenic
1049846353 8:144803751-144803773 GAACCTGGCCTCACTAGGTGAGG + Exonic
1052819772 9:33129430-33129452 GGACCTGGCCCCACTGGGAACGG + Intronic
1052997659 9:34559744-34559766 GCTCCTGCCACCGCTGGGGGTGG + Intronic
1056094927 9:83243083-83243105 GCTGCCGAGCCCACTGGGTGGGG + Intronic
1058259781 9:102814478-102814500 GTTCCAGGCGCCACTGGGGGTGG - Intergenic
1060524992 9:124315442-124315464 GCCCCCGGCCACAGTGGGTGAGG + Intronic
1061503993 9:131020305-131020327 GCTCTTGGCACTTCTGGGTGTGG + Intronic
1061811120 9:133163349-133163371 GCTCCCGGCCTCAGTGGATGGGG + Intronic
1062338186 9:136081741-136081763 GCTGCTGCCGCCACTTGGTGGGG - Intronic
1062446471 9:136597409-136597431 TGGCCGGGCCCCACTGGGTGGGG + Intergenic
1062498427 9:136842389-136842411 GGTGCAGCCCCCACTGGGTGCGG + Intronic
1185470031 X:376656-376678 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470047 X:376717-376739 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470139 X:377075-377097 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470169 X:377193-377215 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470229 X:377429-377451 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470259 X:377547-377569 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470304 X:377726-377748 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470320 X:377787-377809 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470351 X:377909-377931 CATGGTGGCCCCACTGGGTGTGG - Intronic
1190569637 X:51768327-51768349 CCTCCTGGCCTCACTGGGACAGG - Intergenic
1191715347 X:64190372-64190394 GGACCTGGCCCCACTGGAAGAGG + Exonic
1193449464 X:81647566-81647588 GGTCGTGGCCACTCTGGGTGGGG + Intergenic
1194558808 X:95395636-95395658 GCTCCTGCCCTCACTAAGTGAGG + Intergenic
1195223577 X:102769349-102769371 TCTTCTGGCCCCAGTGAGTGTGG + Intergenic
1195263142 X:103153692-103153714 TCTCCTGTCCCCAGTGAGTGTGG + Intergenic
1195293319 X:103450046-103450068 CCTCCTGGCCCCAGTGAGTGTGG + Intergenic
1195300401 X:103524573-103524595 CCTCCTGGCCCCAGTGAGTGGGG - Intergenic
1196196318 X:112841238-112841260 GCTCCCCGCCCCACTGCGGGAGG + Intergenic
1196602987 X:117623114-117623136 GTTCCAGACCCCACTGGGGGGGG + Intergenic
1197240020 X:124114018-124114040 GCACCTGGGTCCACAGGGTGGGG + Intronic
1197762076 X:130035045-130035067 GATCCTGGCCCCTCTGCGAGAGG - Intronic
1200122407 X:153797408-153797430 CCTTCTGCCCCCTCTGGGTGTGG - Intronic