ID: 1026929386

View in Genome Browser
Species Human (GRCh38)
Location 7:74215455-74215477
Sequence GGCCACAGACTGTCACCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026929384_1026929386 0 Left 1026929384 7:74215432-74215454 CCGGGTGCGTCTGCGTGAGTGGT 0: 1
1: 0
2: 1
3: 5
4: 70
Right 1026929386 7:74215455-74215477 GGCCACAGACTGTCACCTCCAGG 0: 1
1: 0
2: 0
3: 18
4: 217
1026929378_1026929386 30 Left 1026929378 7:74215402-74215424 CCTGAGTTGCTCTGGGGTGGGCG 0: 1
1: 0
2: 1
3: 9
4: 154
Right 1026929386 7:74215455-74215477 GGCCACAGACTGTCACCTCCAGG 0: 1
1: 0
2: 0
3: 18
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026929386 Original CRISPR GGCCACAGACTGTCACCTCC AGG Intronic
900423014 1:2563821-2563843 CTCCTCAAACTGTCACCTCCCGG + Exonic
900679224 1:3907169-3907191 GGCCCCACAGTGTCTCCTCCTGG - Intergenic
901137480 1:7007430-7007452 GGCAACAGAATGTCACACCCAGG + Intronic
901235041 1:7663175-7663197 GGCCACAGACTCTCAGCCCTTGG - Intronic
902260944 1:15224362-15224384 GGCCACACACTGTGACCTTTGGG + Intergenic
902546281 1:17192664-17192686 CGCCAGAGACTGTCTCTTCCTGG + Intergenic
902789601 1:18758535-18758557 GCCCACATCCTGTCACTTCCAGG + Intergenic
903439578 1:23377475-23377497 GGCCACAGACTGTCATCAGCAGG - Intergenic
903578942 1:24356889-24356911 GACCACAGACTGTCAGCGCTGGG - Intronic
903919691 1:26790801-26790823 GGCCACATCCTTTCACCACCAGG - Exonic
904600609 1:31670701-31670723 AGCCCCAGACTGTGCCCTCCAGG - Intronic
905295527 1:36952015-36952037 GCCCACAGACTGTCAGCACAGGG + Intronic
905946115 1:41902524-41902546 GGCTACAGACTGTCATGGCCAGG + Intronic
909840750 1:80320052-80320074 GGCTACCGCCTGACACCTCCAGG - Intergenic
909977836 1:82066028-82066050 GGGTGCAGACTGACACCTCCAGG + Intergenic
911745353 1:101435854-101435876 GGCCACAGTCTGTCACTGACAGG - Intergenic
912529532 1:110310336-110310358 GGCCACAGAACGTAAGCTCCGGG + Intergenic
913317730 1:117566696-117566718 AGCCATGGACTGTGACCTCCAGG + Intergenic
920046171 1:203133946-203133968 AGCCACAGACAGTCACCTGCGGG - Intronic
922910992 1:229217039-229217061 AGCCACAGACAGTGACCACCAGG + Intergenic
1063497058 10:6519932-6519954 CGCCAAAGACTGTCTCTTCCCGG + Intronic
1067407173 10:46033673-46033695 AGCCCCAGAGTGTGACCTCCAGG + Intronic
1069887838 10:71635042-71635064 GGGCACAGACTTCCAACTCCTGG - Intronic
1069939367 10:71943995-71944017 TGCCACAGTGTGTCACCTGCCGG + Intergenic
1072019375 10:91383097-91383119 GGCCACAGACTGTCTTTTTCTGG + Intergenic
1072629560 10:97135884-97135906 GGGCACAGTGTGTCAGCTCCTGG - Intronic
1073334871 10:102699057-102699079 TGCCACTGACTGTCACCCCTAGG - Intronic
1075719834 10:124578152-124578174 CACCACATGCTGTCACCTCCAGG + Intronic
1076218257 10:128712877-128712899 GGCCACAGCATGACACCTACGGG + Intergenic
1078104895 11:8352194-8352216 GGCCACAGCATCTCTCCTCCCGG - Intergenic
1082023681 11:47555504-47555526 GGCCACAGACTGTTAGCCCAAGG + Intronic
1084887640 11:72221428-72221450 GGACACAGACTTTCAGCCCCTGG - Intronic
1084889131 11:72228152-72228174 GGCCAGAATCTGTCACCCCCAGG - Intronic
1085647409 11:78234994-78235016 AGCGACAGACTTTCTCCTCCCGG + Intronic
1085749315 11:79146764-79146786 ATCCACAGACTTTCAGCTCCAGG + Intronic
1086399169 11:86446751-86446773 GGCCACATCCTGTCATGTCCTGG - Intronic
1087278653 11:96185590-96185612 GGCCGCAGACTGGCATCACCTGG + Intronic
1091970226 12:4780479-4780501 GGCCACTGACTGTCACTTGCAGG - Intronic
1094598951 12:31891621-31891643 GGCCACAGTCTCTGACCTTCTGG + Intergenic
1094675203 12:32612852-32612874 AGCCCCAGACTGTCATTTCCAGG - Intronic
1095173540 12:39062741-39062763 GGCCAATGCCTGTCATCTCCTGG - Intergenic
1095574013 12:43713964-43713986 GGCCACAGACTGGTACCCACTGG + Intergenic
1096257963 12:50074296-50074318 TGTCCCTGACTGTCACCTCCTGG + Intronic
1096701021 12:53382831-53382853 GCTCACAGCCTGTCACCTCAGGG + Exonic
1097136123 12:56857226-56857248 GGCAACTGACTGACACCACCTGG - Intergenic
1097722619 12:63039790-63039812 GGCCACAGACTCTGTCCTCATGG - Intergenic
1103599311 12:122044041-122044063 GGCCACATACCTTCAGCTCCTGG - Exonic
1107154071 13:37146072-37146094 GACAAATGACTGTCACCTCCAGG - Intergenic
1107821160 13:44286901-44286923 GGCCATAGACTGTGGCCTCAAGG - Intergenic
1110800166 13:79684920-79684942 GGCCACAGAGAGTCACCCCAGGG - Intergenic
1112281415 13:98065963-98065985 GGCCACAGGCTGTGATCTGCTGG + Intergenic
1112563569 13:100533895-100533917 CCCCACAGGCTGTCACCTCATGG - Intronic
1114769676 14:25414360-25414382 GGCCACAGTCTGGCACCCCATGG - Intergenic
1117955934 14:61123743-61123765 GGCCTCAGACTCACACCTCCAGG + Intergenic
1119551253 14:75515496-75515518 GGCCACAAACTGCCCCCTACTGG + Intergenic
1120820871 14:88910653-88910675 GGCCACAGCCTGTCCCCACAAGG + Intergenic
1121582578 14:95041859-95041881 GCCCACACACTTCCACCTCCTGG + Intergenic
1122096215 14:99374868-99374890 CCCCAGAGACTGTCCCCTCCAGG + Intergenic
1122379902 14:101295424-101295446 AGCCACAGACACTCAACTCCAGG - Intergenic
1122413790 14:101538991-101539013 GGCCACAGACCACCACTTCCTGG + Intergenic
1126795993 15:52260981-52261003 GGCCTCAGGCTGTCAACGCCAGG - Exonic
1127379801 15:58420867-58420889 GGCTCCAGTGTGTCACCTCCTGG + Intronic
1129001949 15:72342581-72342603 GGACCCAGACTGCCCCCTCCTGG - Exonic
1129392008 15:75225368-75225390 GGCCAGACAGTGGCACCTCCAGG - Intergenic
1129472367 15:75762794-75762816 GGCCAGACAGTGGCACCTCCAGG + Intergenic
1129522045 15:76192178-76192200 GGCCCCAGAGTGTCACGGCCGGG + Intronic
1130410698 15:83645930-83645952 CCCCAATGACTGTCACCTCCTGG - Intergenic
1132069289 15:98761566-98761588 TACCACTCACTGTCACCTCCAGG + Intronic
1132359146 15:101198040-101198062 GACCACAGTCTGTCACCACAGGG - Intronic
1132485347 16:187432-187454 TGCCACAGGCTGTCCCCTCCAGG - Intergenic
1132507305 16:317527-317549 GGCCACAGACAGTCACGGCCAGG + Intronic
1132881487 16:2163536-2163558 AGTCACAGCCAGTCACCTCCAGG - Intronic
1132889181 16:2195897-2195919 TGCTAGGGACTGTCACCTCCCGG + Intronic
1133070687 16:3244758-3244780 GGCCACAGACTGTCATGTACTGG + Intronic
1134261497 16:12654760-12654782 AGACACAGAACGTCACCTCCAGG - Intergenic
1137604937 16:49781009-49781031 GGCCACAGCCAGGCAGCTCCAGG + Intronic
1138660219 16:58512237-58512259 GCCCACACTCTGCCACCTCCTGG + Exonic
1140204380 16:72921803-72921825 GGCCAAGGCCTGTCTCCTCCTGG - Intronic
1141646579 16:85370989-85371011 GGCCACAGCCAGCCACCGCCGGG - Intergenic
1141880724 16:86857158-86857180 GGCCGCAGGGTGTCCCCTCCTGG - Intergenic
1141903250 16:87006486-87006508 GGCCACATACTGTGAGCTCAGGG + Intergenic
1142967517 17:3590669-3590691 GGCCAGAGGCTGTGACTTCCAGG + Intronic
1145389440 17:22444242-22444264 GGCCACAGGCTGTGCCATCCAGG + Intergenic
1146655573 17:34632802-34632824 GGACCCAGACTGTCATTTCCAGG - Exonic
1147912484 17:43864352-43864374 GGGCACAGGCTGGCACCTTCTGG - Intergenic
1150350764 17:64442813-64442835 GGCCACACCCTGCCACCACCAGG - Intergenic
1152537799 17:80960560-80960582 TGCCACTGCCTGCCACCTCCTGG + Intronic
1152755607 17:82085769-82085791 GGCCACCGACCGCCACCCCCAGG - Exonic
1154102463 18:11488882-11488904 TGCCACAGACTCTGTCCTCCGGG - Intergenic
1155146567 18:23088728-23088750 GGCCACAGAGCCGCACCTCCAGG - Intergenic
1156459822 18:37315468-37315490 GGGCACAGACTGGGACCACCAGG - Intronic
1157618412 18:49001465-49001487 GCCCAGAGCCTGTCTCCTCCTGG - Intergenic
1160990813 19:1859639-1859661 GGCCTCAGGCTGCCTCCTCCAGG + Intronic
1162189702 19:8935201-8935223 AGCCCCAAACTGTGACCTCCTGG - Exonic
1164207484 19:23070766-23070788 GGACCCAGACTGCCACCCCCGGG + Intergenic
1164244146 19:23415964-23415986 GGCAACAGCCTGTCACCGGCTGG + Intergenic
1164518820 19:28961118-28961140 GGCAACAGACTGACCCCACCTGG + Intergenic
1166140330 19:40801985-40802007 GGCCACAGACTGACACCAGGAGG - Intronic
1166292073 19:41869700-41869722 GGCCGCAAACTGACACCTCAGGG + Exonic
1167498389 19:49832019-49832041 CGCCCCTGACTGTCACCTACAGG - Exonic
1167943288 19:52964695-52964717 GGCCACAGGCCCTCACCACCAGG + Intergenic
927191767 2:20521989-20522011 GGCCACAGGCTCTCTCCTCCTGG + Intergenic
927465762 2:23335424-23335446 GGCCTGAGTCTGTCACCTACAGG + Intergenic
927471023 2:23376786-23376808 GGACACAGACTGTGAACACCAGG - Intergenic
929238947 2:39633877-39633899 GGCCACAGCCAGTCACTTTCAGG - Intergenic
929574059 2:43041309-43041331 GCCCTGTGACTGTCACCTCCAGG - Intergenic
932940244 2:76155810-76155832 GGCCACAGTTTGTCAGCCCCTGG - Intergenic
933155100 2:78964539-78964561 GCACACAGACTGTGGCCTCCTGG - Intergenic
935095583 2:99941184-99941206 GGCCACAGACGGTGACCACAGGG + Intronic
935717847 2:105954308-105954330 GGCCACAGATCCTCACCACCTGG + Intergenic
936676738 2:114724421-114724443 TGCCAGAGACTGTCTCTTCCTGG - Intronic
937759347 2:125581682-125581704 TGCCAAGCACTGTCACCTCCCGG - Intergenic
939722141 2:145667163-145667185 GGCCACAAGCTGTCTCCTCTTGG - Intergenic
941933703 2:170966832-170966854 AGCCACAGAGTGCCACCTTCTGG - Exonic
943854008 2:192764726-192764748 GGCCACATACTGGTATCTCCTGG - Intergenic
947462216 2:230313431-230313453 GGCCACGGGGTGTCACTTCCAGG - Intergenic
947714627 2:232333403-232333425 GGCCAGAGACTCTTCCCTCCTGG + Intronic
947793481 2:232880484-232880506 GGCCTCAGGCTGTGACCTCCAGG - Intronic
948667428 2:239545454-239545476 GCCCAGAGACAGCCACCTCCTGG + Intergenic
1169132132 20:3171825-3171847 GGCAACAGGCTGTCATCTCAGGG - Intronic
1170284043 20:14685279-14685301 TGCCACAGAGTGACAGCTCCTGG + Intronic
1170678632 20:18504989-18505011 GGCCGCAAACTGACACCTCAGGG + Intergenic
1171207416 20:23291979-23292001 GGCCTCAGCCTGTCGGCTCCTGG - Intergenic
1173649242 20:44652265-44652287 GAACACAGACAGTCCCCTCCTGG + Intergenic
1174393032 20:50229563-50229585 CGCCAGAGACTGCCTCCTCCAGG + Intergenic
1174558534 20:51413351-51413373 GGACACAGTCTGTCTCCTCAGGG + Intronic
1174800783 20:53561492-53561514 TGCCATAAAGTGTCACCTCCAGG - Intergenic
1174839565 20:53888774-53888796 GGCCACAGTTTGCCAACTCCTGG - Intergenic
1175135452 20:56820221-56820243 GGAAACAGCCTGTCACCTCATGG + Intergenic
1175277073 20:57779497-57779519 TTCCCCAGACTGTCAGCTCCAGG + Intergenic
1176106537 20:63392219-63392241 GCCCACAGACCTCCACCTCCTGG + Intergenic
1177035412 21:16036965-16036987 GACCACAGGCTCTCACCACCAGG + Intergenic
1180600152 22:17010132-17010154 GGCCTCTGACTGTCTTCTCCTGG + Intergenic
1182177449 22:28305317-28305339 TGCCACAGGCTGAAACCTCCTGG - Intronic
1182220186 22:28752594-28752616 GACTACAGACGGTCACCACCAGG - Intronic
1182223550 22:28777645-28777667 GACCACAGGCTTGCACCTCCAGG + Intronic
1183934678 22:41255422-41255444 GGCCACCCACCTTCACCTCCAGG + Intronic
1184401790 22:44278774-44278796 GGCCACAGTCAGCCACATCCAGG + Intronic
1184664516 22:45980771-45980793 GGCCCCAGATGGTCACCTCTGGG + Intergenic
1184785060 22:46667674-46667696 GGCAACAGCCTGCCTCCTCCAGG - Intronic
949388204 3:3529216-3529238 GGTCATAGTCTGTCATCTCCTGG + Intergenic
949727068 3:7061485-7061507 GGCTACAAACAGTCAACTCCGGG - Intronic
950881402 3:16325695-16325717 GGCCGCAGACTGGCTCCCCCTGG + Intronic
951339302 3:21465442-21465464 GGCCACAGCCTCTCATCACCTGG + Intronic
953364991 3:42336705-42336727 GGGCACCCACTGTCAGCTCCAGG + Intergenic
954801500 3:53189680-53189702 GCCCAGAGCCTGTCATCTCCGGG + Intronic
955046910 3:55369497-55369519 GGCCAGAGACTGGCAGATCCTGG + Intergenic
955476903 3:59346584-59346606 GGCCATAGAAAGTCACCTGCTGG + Intergenic
956520321 3:70096592-70096614 GGTCACAGAATGTCACTTTCAGG - Intergenic
956607992 3:71092397-71092419 AGACACAGACTGGCACATCCTGG - Intronic
959056734 3:101574483-101574505 GGCCACTGTTCGTCACCTCCTGG + Intronic
959140027 3:102474454-102474476 GGCCACAGACTTTGTCCTCAGGG + Intronic
961185468 3:124911331-124911353 GGCCACAGACTGGCAAATCTGGG + Intronic
961646498 3:128395443-128395465 AGCCACAGACAGTCACACCCGGG - Intronic
964580391 3:158227911-158227933 GGCTATAGTTTGTCACCTCCTGG + Intronic
964722947 3:159785482-159785504 GGCCAATGGCTGTCAACTCCTGG - Intronic
966193028 3:177288415-177288437 TGCCAGAAACTGTCTCCTCCTGG - Intergenic
966734525 3:183178838-183178860 GGCCGCAGACTGGGAGCTCCCGG - Exonic
967325122 3:188231125-188231147 GGGAACAGTGTGTCACCTCCAGG - Intronic
967914736 3:194570320-194570342 GGCCACAGACAATCTCCTTCTGG - Intergenic
967961199 3:194925762-194925784 GGCCAAAGACTGCCTCCCCCAGG + Intergenic
968487154 4:868185-868207 AGGGACAGACTGTCACCACCTGG - Intronic
968525203 4:1053491-1053513 GGGAACTGACTGTCCCCTCCGGG - Intergenic
968525337 4:1054045-1054067 GGCAGCTGACTGTCCCCTCCGGG - Intergenic
968525442 4:1054506-1054528 GGCAGCTGACTGTCCCCTCCGGG - Intergenic
968525607 4:1055213-1055235 GGCAGCTGACTGTCCCCTCCGGG - Intergenic
969264911 4:6057908-6057930 GGGCACAGACTGCCAGCTCCCGG - Intronic
969710715 4:8841403-8841425 GTCCCCAGACTGTGGCCTCCAGG - Intergenic
970900451 4:21152662-21152684 GGCCACAGACTGACAGGTCCTGG + Intronic
978374076 4:108056975-108056997 GGCCACAGGTCGGCACCTCCTGG - Intronic
979624636 4:122830882-122830904 GCACACAGGCAGTCACCTCCTGG - Intronic
981566563 4:146107814-146107836 AGCCAATGACTGTCACTTCCTGG + Intergenic
982340971 4:154298268-154298290 GGCCAGAGACTGTAGCATCCAGG - Exonic
982924739 4:161321262-161321284 TGCCACAGACTCTAACCTGCAGG - Intergenic
985180693 4:187258318-187258340 AGCCATAAACTGTCAACTCCTGG + Intergenic
988707337 5:33739181-33739203 CGTCACACACTGTCAGCTCCAGG - Intronic
992021638 5:72630535-72630557 GGCCACAGTGTGGCACCTGCCGG + Intergenic
994358538 5:98823467-98823489 GGCCATAGTTTGTCAACTCCTGG - Intergenic
997197895 5:131991781-131991803 GGCCAGAGCCTGCCACCTCTTGG + Intronic
997443044 5:133922045-133922067 GGTCACAGACTCTCCCCTGCTGG + Intergenic
997605602 5:135173732-135173754 GGGCCCAGAGTGTCACCTCTTGG - Intronic
1000006255 5:157187566-157187588 GGCCACACACTACTACCTCCAGG - Intronic
1001579987 5:172791755-172791777 GTCCACAGTCTGTCCCCTCTTGG - Intergenic
1001722056 5:173864887-173864909 AGCCCCTGACTGACACCTCCAGG + Intergenic
1001736143 5:174003972-174003994 TGTCACAGGCTTTCACCTCCAGG - Intronic
1002689269 5:181038898-181038920 GAGCACAGACAGTCACCTCCAGG + Intergenic
1002781246 6:368353-368375 GGGGACAGAATGTCACCTTCAGG - Intergenic
1002900196 6:1404601-1404623 GCCCACAGACAGGCCCCTCCAGG + Intergenic
1003691375 6:8357375-8357397 GGACACAGACAGTCGGCTCCAGG - Intergenic
1004187405 6:13432700-13432722 GGCCACAGGCTGGAACCTCAAGG - Intronic
1005421705 6:25657844-25657866 GAAGACAGACTGTCACCTCAGGG + Intronic
1006637706 6:35472378-35472400 AGCCCCAAACTGTCACCTGCTGG - Intergenic
1012474498 6:99604944-99604966 GGCCACACACTGTGGCCTCTGGG - Intergenic
1013482164 6:110562233-110562255 GGCCATAAACTGACACCTCAGGG - Intergenic
1013752753 6:113426175-113426197 GGCCACAGACTGACCCTTCCTGG - Intergenic
1014274370 6:119370009-119370031 GGCCATAGAGTTTCACCTTCAGG - Intergenic
1015305378 6:131701059-131701081 TGTCACAGAATGTCTCCTCCTGG - Exonic
1015519498 6:134115884-134115906 GGCCACAGAGTCTCAACTGCTGG - Intergenic
1016021983 6:139245600-139245622 GGCCCAAGACTGTCAGCCCCTGG + Intronic
1018027799 6:159819350-159819372 GGCCTCAGCCTGTCACTTACTGG - Exonic
1020974212 7:14984976-14984998 GGCCACATACTGGAACCTCCTGG - Intergenic
1021368209 7:19808128-19808150 TGCCATAGACTATAACCTCCAGG - Intergenic
1021793553 7:24230045-24230067 GGCCACAGATTGTCACCATCTGG - Intergenic
1023678158 7:42652530-42652552 GGCCACAGTTTGCCACCCCCTGG - Intergenic
1024711314 7:52018386-52018408 GGCCACACACAGAGACCTCCCGG - Intergenic
1026596643 7:71738647-71738669 GGCCAAAGACTTTCTCTTCCTGG + Intergenic
1026929386 7:74215455-74215477 GGCCACAGACTGTCACCTCCAGG + Intronic
1026953780 7:74364309-74364331 GGCCTCTGACTGTTACCTCCAGG - Exonic
1027146551 7:75699611-75699633 GGCCACAGACTGGCGTCTCGAGG - Intronic
1027242801 7:76343818-76343840 ACCCACAGTCTCTCACCTCCAGG - Intronic
1033668040 7:143462136-143462158 GGCAACTGACTGACACCTCTAGG - Intergenic
1033739488 7:144259286-144259308 TGTCACAGAATGTCTCCTCCTGG - Exonic
1036620791 8:10423548-10423570 GGACGAAGACTGTCACCTCTGGG - Intronic
1037744151 8:21629949-21629971 GGCCACAGTCAGCCACCCCCAGG + Intergenic
1038315639 8:26482339-26482361 GCCCACAGCCTGTCTCATCCAGG + Intronic
1038665269 8:29532160-29532182 GGACAGAGGCTGACACCTCCGGG - Intergenic
1042937199 8:74071632-74071654 GTCCACTGCCTCTCACCTCCAGG + Intergenic
1047493962 8:125396641-125396663 GGCCACAAGCTTTCATCTCCAGG - Intergenic
1048665319 8:136654860-136654882 GTCCACAGCCTGTGATCTCCAGG + Intergenic
1049198919 8:141330423-141330445 TGCTACAGACTGCCAGCTCCAGG - Intergenic
1049302337 8:141878251-141878273 AGCCACAGCCTTTCACCGCCTGG - Intergenic
1049393213 8:142382628-142382650 AGCCACCCACTGTCACCTTCAGG + Intronic
1050355799 9:4781657-4781679 GTCCACAGCCTGTCATCTCATGG + Intergenic
1056462170 9:86818573-86818595 GGGCCCAGGCTGTCACTTCCAGG + Intergenic
1057306597 9:93916082-93916104 GGGCACAGGCTGCCAGCTCCAGG + Intergenic
1061670055 9:132183539-132183561 TGCCCCAGCCCGTCACCTCCAGG + Intronic
1061919721 9:133776185-133776207 GTCCACAGACAGTCCCCTCCAGG - Intronic
1061989221 9:134149159-134149181 GACTACAGACTGTGACCCCCTGG - Intronic
1062227351 9:135460249-135460271 GGACACTGCCTGCCACCTCCAGG + Intergenic
1203793018 EBV:161603-161625 GGCCACAGACTGTCTTAGCCAGG - Intergenic
1186514667 X:10158349-10158371 GGCCATCGACCCTCACCTCCCGG + Exonic
1192592606 X:72373178-72373200 GGCCATAGTTTGTCAACTCCTGG - Intronic
1194130867 X:90080130-90080152 TGCCACAGCGTGTCACCTCTGGG - Intergenic
1196750964 X:119116892-119116914 GGCCACAGCTTGTCATCTCTGGG + Intronic
1199202290 X:145106671-145106693 GGCCATAGTCTGTCAACTCCTGG - Intergenic
1199860385 X:151796073-151796095 GGTCACTTATTGTCACCTCCAGG + Intergenic