ID: 1026930683

View in Genome Browser
Species Human (GRCh38)
Location 7:74221519-74221541
Sequence ATGGCCCCCAAGAGGAGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026930672_1026930683 27 Left 1026930672 7:74221469-74221491 CCCAGGAAGTGGGGGTGGGGGAA 0: 1
1: 0
2: 8
3: 84
4: 686
Right 1026930683 7:74221519-74221541 ATGGCCCCCAAGAGGAGCAATGG 0: 1
1: 0
2: 1
3: 13
4: 155
1026930677_1026930683 -9 Left 1026930677 7:74221505-74221527 CCTGGCAGACCCCCATGGCCCCC 0: 1
1: 0
2: 3
3: 36
4: 346
Right 1026930683 7:74221519-74221541 ATGGCCCCCAAGAGGAGCAATGG 0: 1
1: 0
2: 1
3: 13
4: 155
1026930673_1026930683 26 Left 1026930673 7:74221470-74221492 CCAGGAAGTGGGGGTGGGGGAAT 0: 1
1: 0
2: 10
3: 75
4: 612
Right 1026930683 7:74221519-74221541 ATGGCCCCCAAGAGGAGCAATGG 0: 1
1: 0
2: 1
3: 13
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026930683 Original CRISPR ATGGCCCCCAAGAGGAGCAA TGG Intronic
900507355 1:3036401-3036423 ATAGCCCCCAAGGTGAGCACTGG - Intergenic
900566972 1:3338322-3338344 ATTGGGCCCCAGAGGAGCAAGGG - Intronic
905110401 1:35590455-35590477 ATGGCCCCAAGGTGGGGCAATGG + Intronic
905695045 1:39967813-39967835 AGGGCCACCAAGATGAGAAATGG - Exonic
906633088 1:47388939-47388961 ATGGCCACCAAGAGGCGCCCAGG + Intergenic
907183177 1:52588538-52588560 ATGGCACCCATGTGGAGCCATGG + Intergenic
908851028 1:68375810-68375832 AGGGACCCAAAGAGGGGCAATGG - Intergenic
911683863 1:100750258-100750280 ATGGCACCCGGGAGGAGGAAAGG + Intergenic
911686924 1:100788061-100788083 ATGGCCCCAAAGTGCAGCGAGGG + Intergenic
912408031 1:109458053-109458075 ATGGCCACCGAGAGGTGGAAGGG - Intergenic
916509150 1:165455825-165455847 CTGGCCCCCAAGAAGGGCACTGG - Intergenic
920304161 1:205008240-205008262 TCTGCCCCCAAGAGGAGCAAAGG + Intronic
923032823 1:230263439-230263461 CTGGCCCACAGGAGCAGCAAGGG - Intronic
1063866447 10:10370120-10370142 ATGGCCCCCAAGAGTAACGTTGG - Intergenic
1064397520 10:14993448-14993470 TGGTCCCCCAAGAGGAGGAATGG - Intergenic
1064570766 10:16690621-16690643 ATGGACTCCAAGAGGAGACATGG - Intronic
1065099969 10:22322099-22322121 ATGGCCCCCGAGAGGAGTACTGG + Intronic
1067443624 10:46327137-46327159 AGAGCCCTCAAGAGGAGCGAGGG + Intronic
1071829863 10:89360924-89360946 ATGGCACCTAAGAGGAGGCAAGG - Intronic
1075555710 10:123430190-123430212 ATTGCCGACAATAGGAGCAACGG + Intergenic
1076783355 10:132736651-132736673 ATGGCCGGCAAGAGCAGCCAAGG + Intronic
1078508140 11:11967013-11967035 ATGGCCACCAGGGGCAGCAATGG - Exonic
1081654649 11:44849463-44849485 ATTGCCCCCAACAGAGGCAAGGG + Intronic
1083720914 11:64603133-64603155 ATGGCCCCCCAGAGGCCCAGGGG - Intergenic
1084710947 11:70843346-70843368 GTGGGCCCCAGGAGGAGGAAGGG + Intronic
1084747818 11:71184361-71184383 CTGGCCCCCACGAAAAGCAATGG + Intronic
1085145687 11:74194008-74194030 AGGACCCCCAAGAGAAACAAAGG - Intronic
1088114468 11:106299420-106299442 AAGGCTCCCCAGAGGATCAATGG - Intergenic
1090831190 11:130421936-130421958 CTGGCCCCCCTGAGGAGCAGAGG + Intronic
1092432689 12:8421674-8421696 TTGTCCCCCGAGAGGAGGAATGG - Intergenic
1092435286 12:8442312-8442334 TTGTCCCCCGAGAGGAGGAATGG - Intergenic
1092955675 12:13547369-13547391 ATGGCCACCCAGAAGAGGAAAGG + Exonic
1092989918 12:13886698-13886720 ATGGCCCTCAAGAGGAACTGGGG - Intronic
1093371735 12:18374589-18374611 ATGGCACCTAAGAGCAGGAAGGG - Intronic
1093737821 12:22642791-22642813 AAGGCTCCCAAGTGGAACAAAGG - Intronic
1095239469 12:39839671-39839693 ATGGCCCAGAACAGAAGCAAAGG - Intronic
1096485229 12:51975820-51975842 ATGGCCCCAGAGCCGAGCAAAGG + Intronic
1098864170 12:75743300-75743322 ATGGCCACCAAGAGGTGGAGGGG + Intergenic
1103611482 12:122126882-122126904 GTGCCCTCCAGGAGGAGCAAAGG - Intronic
1105426163 13:20296743-20296765 ATGGCCACCACCAGGAGCTAGGG - Intergenic
1112579453 13:100665692-100665714 GTGGCCCCAAAGAGCAACAAAGG + Intronic
1116015309 14:39399735-39399757 AGAGCCCCGAAGACGAGCAATGG + Exonic
1118843383 14:69528545-69528567 CTGGCCCCCAAGTGGAGCTCCGG - Exonic
1120070496 14:80097300-80097322 ATGGCTCCCAATAGGAGCTTAGG - Intergenic
1121839670 14:97122587-97122609 ATGACCCCCAAAAGGAGTAATGG - Intergenic
1122403459 14:101481449-101481471 ATGGCTCCCAAGAGGAGCACTGG + Intergenic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1131971110 15:97893804-97893826 ATGGCCCCCAACAGGCCCACTGG - Intergenic
1132950922 16:2562161-2562183 ATGGCGCTCTAGGGGAGCAAGGG - Intronic
1133415274 16:5601801-5601823 ATTGCCCACAATAGGATCAAAGG + Intergenic
1141847958 16:86623722-86623744 ATGTCCCACAGGAGGAGCGAAGG - Intergenic
1141891017 16:86926519-86926541 ATGGCCGGGAAGAGGAACAAAGG - Intergenic
1143387763 17:6542146-6542168 AGGGCCCCCATGAGGAGCCAGGG - Intronic
1147319296 17:39636405-39636427 CAGGCACCCAGGAGGAGCAAGGG - Exonic
1148873638 17:50673614-50673636 ATGCCCCCGATGAGGACCAAGGG + Exonic
1149048519 17:52276685-52276707 ATGGCTGGTAAGAGGAGCAACGG + Intergenic
1151420156 17:73991658-73991680 ATGCCCCCAAAGATGAGCAGAGG + Intergenic
1151731686 17:75915071-75915093 AGCGCGCCCTAGAGGAGCAAAGG - Exonic
1152250068 17:79207873-79207895 CTTGCCCCCAAAAGGAGGAATGG + Intronic
1152438398 17:80289844-80289866 ATGCCCCCGCAGGGGAGCAAAGG + Intronic
1153339798 18:3961771-3961793 ATGGCCCACAAGTGGGGCAAGGG + Intronic
1153822879 18:8847376-8847398 ATGGTCCCCAAGTGGGGCATGGG - Intergenic
1157188953 18:45564602-45564624 ATGCCCCCCAAAATGAGGAAGGG + Intronic
1161784031 19:6312038-6312060 AGGGCCCCAAAGAGGGTCAAGGG + Intronic
1162041143 19:7971729-7971751 AGGGCCCCCATGAAGTGCAAAGG + Intronic
1162723583 19:12676513-12676535 ATGGCCACCAGGGGGAGCATGGG + Intronic
1163417626 19:17195977-17195999 CTGGCCCCCAATACGAGCAGTGG - Intronic
1168270887 19:55249161-55249183 CAGGCCCCCCAGAGGAGCAGGGG - Intronic
925412902 2:3650287-3650309 CCGGCCCCCAGGAGGAGCAGTGG - Intergenic
925916581 2:8611264-8611286 ACGGCCCCCAATGGGACCAAGGG - Intergenic
928094974 2:28398982-28399004 TTGGCTCCCAAGAAGAGAAAAGG - Intronic
928518312 2:32064090-32064112 ATGGCAGCCAAGAGGAGCTCCGG + Exonic
929858764 2:45657526-45657548 ATAGCCCCCAAAATGAGCATGGG + Intronic
932715996 2:74101118-74101140 ATGTCCCCCAAGAGGACTAACGG + Exonic
933466439 2:82658053-82658075 ATGGACAACAAGAGGAGCAGAGG + Intergenic
935142938 2:100370376-100370398 ATGGACCCCAATAAGAACAAAGG - Intergenic
935267406 2:101406726-101406748 ATGGCCATCAAGAGGGGCAGGGG + Intronic
944891225 2:204119432-204119454 ATGGCCTCCAAAAGAAGCAGTGG - Intergenic
946296007 2:218783903-218783925 ATGGCCCCTCAGAGGAACCAGGG - Intronic
948030495 2:234813847-234813869 AAGGCCCCCGAGAGGGTCAAGGG - Intergenic
948370868 2:237488239-237488261 AAGGCTCCCAATAGGTGCAAAGG + Intronic
1173758517 20:45539352-45539374 ATGTCCCCCAAAAGGATGAATGG + Exonic
1174135758 20:48377887-48377909 ATGGCCCCCAAGAGTAGTGCTGG - Intergenic
1181306976 22:21922632-21922654 CTGGCCGCAGAGAGGAGCAATGG + Exonic
1182419458 22:30241907-30241929 ATTGCTCCCAAGAGGAGGAGAGG - Exonic
1182681084 22:32080470-32080492 AGGGCCCTCAGGAGCAGCAATGG + Intronic
950190309 3:10971937-10971959 GTGCCCTCCAGGAGGAGCAAAGG + Intergenic
954292176 3:49655444-49655466 CTGGGCCCCATGAGGAGCAGAGG + Exonic
954538176 3:51376785-51376807 ATGTCCTCCATGATGAGCAAAGG - Intronic
955050432 3:55405509-55405531 AAGGCCCCCCAGAGGAGAACTGG + Intergenic
961271969 3:125696271-125696293 CAGTCCCCCAAGAGGAGGAATGG + Intergenic
961312819 3:126014654-126014676 ATGGTCCCCTAAGGGAGCAAGGG + Intronic
961391764 3:126556308-126556330 CTGCCCCCAAAGAGGGGCAAGGG - Intronic
968988950 4:3895731-3895753 ATGGTCCCCGAGAGGACGAATGG - Intergenic
969025547 4:4169322-4169344 AGGTCCCCCGAGAGGAGGAATGG - Intergenic
969733924 4:8974441-8974463 CGGTCCCCCAAGAGGAGGAATGG + Intergenic
969826403 4:9761862-9761884 ATGGTCCCCGAGAGGAGGAATGG + Intergenic
976306271 4:83562863-83562885 ATAGCCCACAAGAGTAGCAGTGG - Intronic
980574139 4:134663702-134663724 ATGGCACCAAAGAGGAGCTCTGG + Intergenic
982891595 4:160859277-160859299 TTTGCCCCCAAAAGAAGCAAGGG - Intergenic
983588646 4:169383240-169383262 CTGGACGTCAAGAGGAGCAAAGG - Intergenic
985886961 5:2687334-2687356 ATGGCTCCCAGGAGGTGCCATGG - Intergenic
990738850 5:58891861-58891883 ATGGCACCCCCGAGGAACAATGG + Intergenic
995140857 5:108733584-108733606 ATGGCCCCCAAGAGACCCCAGGG + Intergenic
995164010 5:109015985-109016007 CAGTCCTCCAAGAGGAGCAAAGG - Intronic
996756144 5:126937213-126937235 ACTGCCCCCAAGTGGGGCAAAGG - Intronic
996804213 5:127436772-127436794 ATGATCCCCAGGAGAAGCAAAGG - Intronic
997702101 5:135909700-135909722 TTTTCCCCCAAGAGGAGCAGTGG - Intergenic
998949880 5:147382779-147382801 GTGGCTCCCAAAAGGAGGAAAGG + Intronic
1001138584 5:169123749-169123771 ATGGCTACCAAGAGGTGGAAGGG + Intronic
1001476925 5:172057219-172057241 AGTGCCCCCAAGAGGAGCCAGGG - Intronic
1001976528 5:176004501-176004523 ATGGCCACCAAGCGGCGGAAGGG - Intronic
1002240900 5:177839271-177839293 ATGGCCACCAAGCGGCGGAAGGG + Intergenic
1003237469 6:4309373-4309395 ATGTCCCTAGAGAGGAGCAATGG - Intergenic
1003242931 6:4360254-4360276 AGGGCTACCAAGAGAAGCAAGGG + Intergenic
1004672782 6:17813651-17813673 GTGACTCCCAAGAGGAGAAAAGG - Intronic
1005886002 6:30098281-30098303 GTGGCCCCCTTGAGGAGCCAGGG - Intergenic
1005926167 6:30447515-30447537 AGGGCACCCCAGAGGAGGAAGGG + Intergenic
1006142811 6:31940933-31940955 ATGGGCCACAAGGGGTGCAAAGG + Intronic
1006665362 6:35689148-35689170 ATGGCCCCCACAAAGGGCAAGGG - Intronic
1010693499 6:78940795-78940817 ATGACTCTGAAGAGGAGCAAAGG - Exonic
1011208528 6:84928554-84928576 ATGCCTCCCAACAGGAGCTAGGG - Intergenic
1011747346 6:90419067-90419089 ATGGTATCCCAGAGGAGCAAAGG - Intergenic
1012393962 6:98774461-98774483 TTGGCTCCCAGGAGGAGCAAAGG - Intergenic
1013394010 6:109715958-109715980 ATGGACCCCAGGAGTAGCATGGG - Intronic
1014821229 6:125990427-125990449 AGGGCCCCCCAGAGGAGAAAAGG - Intronic
1017313091 6:152997538-152997560 ATGGCCACCAAGAGGTGGAAGGG + Intronic
1017632092 6:156406272-156406294 ATGGCCCTCCTGAGGAGCAAGGG + Intergenic
1021790948 7:24204923-24204945 ATGGCCACCTAGAGCTGCAAGGG - Intergenic
1023808329 7:43890880-43890902 ATGGCCTCCAGAATGAGCAATGG - Intronic
1026337653 7:69408583-69408605 ATTCCCACCAAGAGGTGCAAGGG - Intergenic
1026558476 7:71428416-71428438 ATGTCCACCAAGAAAAGCAATGG - Intronic
1026930683 7:74221519-74221541 ATGGCCCCCAAGAGGAGCAATGG + Intronic
1028591005 7:92494560-92494582 ATGACCCCGCCGAGGAGCAATGG + Exonic
1032625694 7:133589407-133589429 ATGCCTCCCAAGAGGTGGAAGGG - Intronic
1033008880 7:137597695-137597717 ATAGCCCCTAAGAGTAACAAGGG - Intronic
1033801554 7:144908034-144908056 ATGGCCCCTGAGAGCAGAAAGGG - Intergenic
1036239545 8:7070532-7070554 TGGTCCCCCAAGAGGAGGAACGG + Intergenic
1037661550 8:20931871-20931893 ATGGCTACCAAGAGGTGGAATGG - Intergenic
1037724658 8:21473255-21473277 ATGGCCCCCAAGTGGCTCATAGG + Intergenic
1037910679 8:22741949-22741971 AGGGACCCAAAGAGGATCAAGGG + Intronic
1040485940 8:47871320-47871342 AAGGATCCCAAGAGAAGCAAGGG + Intronic
1041394760 8:57379082-57379104 CTGGCCCCCATGAGAAGTAATGG + Intergenic
1041913008 8:63109517-63109539 ATGGCTACCAAGAGGTGGAAGGG + Intergenic
1042266894 8:66917577-66917599 ATGGCTCCCAGGAGGAGTAGAGG - Intronic
1044803390 8:95979951-95979973 ATGGCCCCAAAGACTAGCCAGGG + Intergenic
1048344489 8:133566501-133566523 AGGGCCCCCAGGAGGATTAAGGG - Intronic
1048445435 8:134489482-134489504 ATGGCCCAGGAGAGGAGCAAGGG - Intronic
1048957628 8:139549834-139549856 CGGTCCCCCAAGAGGAGGAATGG - Intergenic
1049270308 8:141692152-141692174 AGGGCCCCTTAGAGGAGCACAGG - Intergenic
1049719914 8:144111032-144111054 CTGCCCCCCAAGGTGAGCAAGGG - Intronic
1050771023 9:9200117-9200139 ATGGCTCCCAGTAGGAGCAGAGG - Intronic
1053477618 9:38393487-38393509 ATAGGCCCCAAGAGTAGGAACGG + Intronic
1054817416 9:69488631-69488653 ATGGCTGCCAAGACGGGCAAGGG + Intronic
1055274236 9:74596217-74596239 ATTGCCCCCAAGAACAGCAGAGG + Intronic
1055748166 9:79473804-79473826 ATGGCCATCATGAGTAGCAAGGG + Intergenic
1056072755 9:83006207-83006229 ATGTCCCCTAAGGGGAGCATTGG - Intronic
1057891590 9:98874109-98874131 ATGGCACCCAGAAGGAGGAAGGG - Intergenic
1058576891 9:106413319-106413341 ACTGCCCACATGAGGAGCAAAGG + Intergenic
1058773658 9:108263725-108263747 ATGTCCCCCACCAGGAGGAAAGG + Intergenic
1060925512 9:127452524-127452546 AGGGCCCGCTAGAGGAGCTAGGG - Intronic
1062271534 9:135712106-135712128 AGAGTCCCCAAGAGGAGCAGCGG + Intronic
1185793413 X:2944865-2944887 ATGGTCACGAAGAGAAGCAATGG + Intronic
1186583105 X:10842107-10842129 TTGAACCCAAAGAGGAGCAAAGG + Intergenic
1189626380 X:42901668-42901690 AGGTCCTCCAAGAGGACCAAAGG - Intergenic
1192977837 X:76304946-76304968 ATGGCCCCTAATAGGATAAAAGG - Intergenic
1193546998 X:82843565-82843587 AGTGACCCCCAGAGGAGCAATGG + Intergenic
1195072356 X:101292676-101292698 GCGGCCCCCTTGAGGAGCAATGG - Intronic
1196406496 X:115367894-115367916 ATATCCCCAAAGAGAAGCAAGGG - Intergenic
1197611149 X:128639639-128639661 ATGGCTTTCAAGAGGACCAAGGG + Intergenic