ID: 1026938380

View in Genome Browser
Species Human (GRCh38)
Location 7:74272207-74272229
Sequence AAATCAGCCGGATTTCGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026938380_1026938384 -2 Left 1026938380 7:74272207-74272229 CCACCACGAAATCCGGCTGATTT No data
Right 1026938384 7:74272228-74272250 TTTTGTATTTTCGGTAGAGATGG 0: 134
1: 13928
2: 213524
3: 137478
4: 63231
1026938380_1026938385 -1 Left 1026938380 7:74272207-74272229 CCACCACGAAATCCGGCTGATTT No data
Right 1026938385 7:74272229-74272251 TTTGTATTTTCGGTAGAGATGGG 0: 54
1: 6913
2: 110028
3: 253414
4: 151702
1026938380_1026938388 19 Left 1026938380 7:74272207-74272229 CCACCACGAAATCCGGCTGATTT No data
Right 1026938388 7:74272249-74272271 GGGGTTTCACTATGTTGGCCAGG 0: 5858
1: 78435
2: 176064
3: 221734
4: 188168
1026938380_1026938386 0 Left 1026938380 7:74272207-74272229 CCACCACGAAATCCGGCTGATTT No data
Right 1026938386 7:74272230-74272252 TTGTATTTTCGGTAGAGATGGGG 0: 51
1: 6338
2: 99124
3: 184226
4: 177269
1026938380_1026938387 14 Left 1026938380 7:74272207-74272229 CCACCACGAAATCCGGCTGATTT No data
Right 1026938387 7:74272244-74272266 GAGATGGGGTTTCACTATGTTGG 0: 3601
1: 48796
2: 104097
3: 133533
4: 102920

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026938380 Original CRISPR AAATCAGCCGGATTTCGTGG TGG (reversed) Intergenic
No off target data available for this crispr