ID: 1026939358

View in Genome Browser
Species Human (GRCh38)
Location 7:74278042-74278064
Sequence GCTTAAGACTGTAGCTGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026939348_1026939358 14 Left 1026939348 7:74278005-74278027 CCCCACTTTGCCCCATAGCAGAA No data
Right 1026939358 7:74278042-74278064 GCTTAAGACTGTAGCTGAGGCGG No data
1026939350_1026939358 12 Left 1026939350 7:74278007-74278029 CCACTTTGCCCCATAGCAGAATG No data
Right 1026939358 7:74278042-74278064 GCTTAAGACTGTAGCTGAGGCGG No data
1026939351_1026939358 4 Left 1026939351 7:74278015-74278037 CCCCATAGCAGAATGACCCAGCT No data
Right 1026939358 7:74278042-74278064 GCTTAAGACTGTAGCTGAGGCGG No data
1026939352_1026939358 3 Left 1026939352 7:74278016-74278038 CCCATAGCAGAATGACCCAGCTC No data
Right 1026939358 7:74278042-74278064 GCTTAAGACTGTAGCTGAGGCGG No data
1026939349_1026939358 13 Left 1026939349 7:74278006-74278028 CCCACTTTGCCCCATAGCAGAAT No data
Right 1026939358 7:74278042-74278064 GCTTAAGACTGTAGCTGAGGCGG No data
1026939353_1026939358 2 Left 1026939353 7:74278017-74278039 CCATAGCAGAATGACCCAGCTCC No data
Right 1026939358 7:74278042-74278064 GCTTAAGACTGTAGCTGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026939358 Original CRISPR GCTTAAGACTGTAGCTGAGG CGG Intergenic
No off target data available for this crispr