ID: 1026940443

View in Genome Browser
Species Human (GRCh38)
Location 7:74284814-74284836
Sequence CAGCTTTCCTTCACACAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026940439_1026940443 28 Left 1026940439 7:74284763-74284785 CCTCATGCAGTTTTAAGCTTAAG No data
Right 1026940443 7:74284814-74284836 CAGCTTTCCTTCACACAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026940443 Original CRISPR CAGCTTTCCTTCACACAGCA GGG Intergenic
No off target data available for this crispr