ID: 1026944730

View in Genome Browser
Species Human (GRCh38)
Location 7:74308258-74308280
Sequence TGCAGGAGCCTCCAGTGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026944720_1026944730 29 Left 1026944720 7:74308206-74308228 CCTCTGGGAGGTGGGACAGTGTC 0: 1
1: 0
2: 1
3: 16
4: 182
Right 1026944730 7:74308258-74308280 TGCAGGAGCCTCCAGTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026944730 Original CRISPR TGCAGGAGCCTCCAGTGCCA GGG Intronic
No off target data available for this crispr