ID: 1026953985

View in Genome Browser
Species Human (GRCh38)
Location 7:74365376-74365398
Sequence CTGAGTAAGGGGCACATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026953985_1026953992 3 Left 1026953985 7:74365376-74365398 CCATCCATGTGCCCCTTACTCAG 0: 1
1: 0
2: 1
3: 22
4: 232
Right 1026953992 7:74365402-74365424 CTCCTTCCGATCTGTGTCTGAGG 0: 1
1: 0
2: 0
3: 7
4: 142
1026953985_1026953994 8 Left 1026953985 7:74365376-74365398 CCATCCATGTGCCCCTTACTCAG 0: 1
1: 0
2: 1
3: 22
4: 232
Right 1026953994 7:74365407-74365429 TCCGATCTGTGTCTGAGGTCAGG 0: 1
1: 0
2: 0
3: 6
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026953985 Original CRISPR CTGAGTAAGGGGCACATGGA TGG (reversed) Intronic
900117659 1:1035335-1035357 CTGAGTTCGGGGGACCTGGATGG + Intronic
902330357 1:15728276-15728298 ATGAGCACCGGGCACATGGAGGG + Exonic
902622968 1:17661045-17661067 CTGAGTAGAGGGCCCATGGTGGG - Intronic
903005091 1:20293169-20293191 GTGAGTAGGGGCCACAGGGATGG - Intronic
903057238 1:20644736-20644758 CTGATCAAGGTGCACATGGAGGG - Intronic
903869734 1:26425300-26425322 CAGAGTAAGCTGCACATGGAAGG + Exonic
904328682 1:29744204-29744226 CTCACCCAGGGGCACATGGAAGG - Intergenic
904680434 1:32225306-32225328 CTGGGTACTGGGGACATGGAGGG + Intronic
904917739 1:33982571-33982593 CTTAGTATGTGGCACATGGTAGG + Intronic
904929466 1:34074883-34074905 CTAAGCAAGGGGCAGATGGAGGG + Intronic
905354162 1:37369438-37369460 CTGAGGAAGAGGTATATGGATGG + Intergenic
905631807 1:39522958-39522980 CTCAGGGAGGAGCACATGGATGG + Intronic
905665954 1:39763229-39763251 CTCAGGGAGGGGCACATGGATGG - Intronic
906101897 1:43269319-43269341 CTGTGTAAGGGGCCCATGGAGGG - Intronic
906670139 1:47648326-47648348 ATGAGAAAGGGGCAAATGGCAGG - Intergenic
908173137 1:61527679-61527701 CTGAGGAAGGGGGAAAGGGAAGG + Intergenic
908192679 1:61719454-61719476 CTGGGTAAAGGGTATATGGATGG + Intronic
911210479 1:95133630-95133652 CTGAGAATGGGGTAGATGGATGG + Intronic
913255739 1:116951694-116951716 CTGAGTCATAGGCACAGGGAAGG - Intronic
914802062 1:150969092-150969114 CTGAGTGAGGGGCAAAGGGGAGG + Exonic
915895905 1:159810358-159810380 CACACAAAGGGGCACATGGAAGG + Intronic
917713290 1:177709232-177709254 CTCAGTAAGGGGCAGACGCAAGG - Intergenic
918344324 1:183593083-183593105 GTGATTAAGGGCCACATGGGAGG - Intronic
919604750 1:199668431-199668453 CTTAGTAAATGGCACATGGCAGG - Intergenic
921252715 1:213312426-213312448 CTGAGAAATTGGCACCTGGAAGG + Intergenic
921577648 1:216855617-216855639 CTGAGTCTGTGGCACGTGGAAGG + Intronic
921814691 1:219550186-219550208 CTGAGAAAAGGCCACCTGGAGGG - Intergenic
922586257 1:226736914-226736936 CTGCGGAAGGGGCACGGGGAGGG + Exonic
1063649430 10:7918449-7918471 TTGAGGAAGAGGCACATGGGAGG + Intronic
1064105687 10:12499270-12499292 CTTAGTAAGATGCAAATGGACGG + Intronic
1066618877 10:37323580-37323602 CTGAATAAGGGGGACAGGAAGGG - Intronic
1066967911 10:42286657-42286679 CTGAGAAAAGGGCATATGGGTGG - Intergenic
1068220530 10:54039488-54039510 CAGAGTAAGGGAGACATTGAGGG - Intronic
1068892101 10:62158562-62158584 CTGAGTTTGGGGCACATGATGGG + Intergenic
1070563894 10:77589326-77589348 CTGAATCAGAAGCACATGGACGG + Intronic
1070829927 10:79411932-79411954 CTCTGTAAGGGGCACATGTGGGG - Intronic
1073398863 10:103240746-103240768 TAGAGTACGGGGCACATGGCAGG + Intergenic
1073453421 10:103622637-103622659 GGGAGGAAGGGGCACAGGGAGGG + Intronic
1074289390 10:112127025-112127047 CAGAGGAAGGTGGACATGGAAGG + Intergenic
1080685206 11:34509608-34509630 CTGAGTGAGGGGGGCAGGGAGGG + Intronic
1085254145 11:75162947-75162969 CTGGGTTTCGGGCACATGGAAGG + Intronic
1088830005 11:113528852-113528874 CTGAGTTAGAGGCAATTGGAAGG - Intergenic
1088833304 11:113556641-113556663 CCAGGGAAGGGGCACATGGATGG - Intergenic
1089121534 11:116138989-116139011 CTGAGGAAGATGCCCATGGATGG - Intergenic
1089528932 11:119114072-119114094 CTGAGCAATGGGCACCTGGCAGG - Exonic
1089622595 11:119730126-119730148 CAGAGTAAGGGGAAGAGGGAAGG - Intergenic
1090024148 11:123153463-123153485 TTTATTAAGGGGCACAAGGAAGG - Intronic
1091073550 11:132592312-132592334 CTGAGGGAGGGGCATATGGAGGG + Intronic
1094229465 12:28086209-28086231 CTAAGTAAGGGTCACAGGAAAGG + Intergenic
1095512730 12:42970870-42970892 CTGAGTTATGGGCAAATGGCAGG - Intergenic
1095893577 12:47258196-47258218 CAGAACAAGGGGCCCATGGAGGG + Intergenic
1098661823 12:73103963-73103985 CTGAGTAAGTGGCCTTTGGATGG - Intergenic
1100071382 12:90723811-90723833 CTGAGCAAGGGGCAGAAGAATGG - Intergenic
1103394498 12:120597457-120597479 CTGACTGATGGGGACATGGAAGG - Intergenic
1104209963 12:126679224-126679246 CTGGGAAAGAGGCACATGGATGG - Intergenic
1104584041 12:130033326-130033348 CTGTCTAAGGGGCTCTTGGATGG + Intergenic
1105730126 13:23205440-23205462 CTGGGTAGGAGGCCCATGGAAGG + Intronic
1106124603 13:26890019-26890041 ATGAGGAAGGGGGACAGGGAAGG + Intergenic
1110061734 13:71048961-71048983 CTGGGGAATGGGCACATGGTAGG + Intergenic
1110789763 13:79574935-79574957 CTGACTAGGGAGCACATGGCAGG - Intergenic
1111376054 13:87380137-87380159 CAGAGTAAGCTGCACGTGGAGGG - Intergenic
1113787020 13:113007326-113007348 CTGAGCCAGGGGCACCAGGAGGG - Intronic
1113815050 13:113163742-113163764 TTAAGAAAGGGGCACATGGTGGG - Intronic
1115808904 14:37083781-37083803 ATGCGTAAGAGTCACATGGAGGG - Intronic
1116986523 14:51225434-51225456 GGCAGTAAGGGGCAAATGGAGGG + Intergenic
1117967571 14:61221484-61221506 ATGGGGAGGGGGCACATGGAGGG - Intronic
1118476066 14:66118435-66118457 TTGGGTAATGGGCACATGAAGGG + Intergenic
1119847787 14:77843450-77843472 GTGATTAAGGGGCAGATGGAGGG + Intronic
1121104413 14:91271142-91271164 CAGAGGGAGGGGCACAGGGAGGG + Intergenic
1122082995 14:99279851-99279873 CCAAGTAAGGGGCAAATGCAGGG + Intergenic
1123138444 14:106052076-106052098 CTGAGTAAAGGAGAGATGGACGG - Intergenic
1124614882 15:31234312-31234334 CTGAGGAAGGGGCAGAAGGGTGG + Intergenic
1128081702 15:64860948-64860970 CAGAGTAAGAGTCACATGGGAGG - Intronic
1129248597 15:74295595-74295617 GTGAGCAAGGGGCAGATGGTAGG + Intronic
1129348480 15:74939499-74939521 GTGAGGAAGTGGCACATGAATGG - Intergenic
1129453257 15:75662567-75662589 CTTAGTACAGGGCAAATGGAAGG - Intergenic
1130232875 15:82109866-82109888 CTTAGTAAGGGTCAGGTGGAGGG + Intergenic
1130626759 15:85523424-85523446 CTGAGTAAGGGCCTGAAGGAAGG - Intronic
1130899782 15:88198668-88198690 CTGAGCATGGGGCACGAGGAGGG - Intronic
1131117857 15:89805540-89805562 CAGGGAAAGGGGTACATGGAAGG + Intronic
1131856561 15:96603305-96603327 CTGAGCAAGCAGCACATGCAAGG + Intergenic
1132568518 16:634155-634177 CTGGGCATGGGGCACCTGGAAGG - Intergenic
1133192939 16:4147652-4147674 CTGTGGAAGGGGCCCATGAATGG - Intergenic
1134453232 16:14376162-14376184 CTGTGTGAGGGGCACAGGGCAGG + Intergenic
1135654479 16:24235797-24235819 CTGAGTAGGGGGGACATGGTCGG - Intergenic
1136746803 16:32597860-32597882 ATGGGTAAGTGGCACAGGGATGG + Intergenic
1138081815 16:54097855-54097877 CTGAGTAAGGCGGTCAAGGAAGG + Intronic
1138416177 16:56872615-56872637 ATGAGTAAGGCTCACCTGGAGGG - Intronic
1139444266 16:66987191-66987213 CTGAGGAAGGGTCACAAGGATGG + Intergenic
1139514891 16:67447090-67447112 CTGAGTGGGGGGCGCAAGGAGGG - Intronic
1140639629 16:76957097-76957119 CTGGGAAATGTGCACATGGAGGG + Intergenic
1141192576 16:81835073-81835095 CCAAGTAAGTGGCACCTGGAAGG - Intronic
1141722927 16:85766780-85766802 CTGGGAAGGGGGCACAGGGAAGG - Intergenic
1203048933 16_KI270728v1_random:857064-857086 ATGGGTAAGTGGCACAGGGATGG + Intergenic
1143044437 17:4065591-4065613 CTGAGTGACAGGTACATGGAAGG - Intronic
1143530999 17:7503362-7503384 CTGAGAGAGGGGGAAATGGAGGG - Intronic
1143660396 17:8321000-8321022 CTGAGGAGGGGGCACATGTTGGG + Exonic
1143847880 17:9786882-9786904 CTGAGAAAGGGACACGTTGAGGG + Intronic
1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG + Intronic
1145815251 17:27790522-27790544 CTGGGTGAAGGGCCCATGGAAGG - Intronic
1146533589 17:33631056-33631078 CTGGGTAAGGAGCAAGTGGAAGG + Intronic
1147127961 17:38385561-38385583 ATTAGTATGGGGCACACGGAAGG - Intronic
1147322731 17:39656097-39656119 TTGAGGAAGAGGCACATGGTGGG + Intronic
1150416919 17:64995439-64995461 CTGAGGAAGGGACAGAAGGATGG + Intergenic
1150944364 17:69728843-69728865 CCTAGGAAGGGGCACAGGGAAGG - Intergenic
1151077402 17:71289163-71289185 CTGAGAAAGAGGCACTTTGAGGG - Intergenic
1151347519 17:73511252-73511274 CTGAGTCAGCCCCACATGGAAGG - Intronic
1152240285 17:79157355-79157377 CTGTGGAAGGGGTGCATGGACGG - Intronic
1152292427 17:79447729-79447751 CTGAGCAATGCTCACATGGATGG - Intronic
1152551008 17:81030215-81030237 AAAAGTAAGGGGCACAGGGAGGG - Intergenic
1153224767 18:2891100-2891122 CTGAGAGAGGAGCTCATGGAGGG + Exonic
1153874089 18:9350446-9350468 CTGAGTAATGGGTAAATGGGGGG - Intronic
1154312163 18:13275789-13275811 CAGAGTATGTGGCACATGGGAGG - Intronic
1156550612 18:38012423-38012445 CTGAGCAAAGGCCACATGGACGG + Intergenic
1157283178 18:46359395-46359417 CTGAGCAGGTGGCACATGGAGGG + Intronic
1157446565 18:47750890-47750912 CTCAGTAAGGGGAACTGGGAGGG + Intergenic
1157554746 18:48606197-48606219 CTGAGGAAGGGGGAAAGGGACGG - Intronic
1158406599 18:57165471-57165493 CAGAGTCAGGGGCAGCTGGATGG - Intergenic
1160099386 18:75905908-75905930 CTGAGAAAGAGGCACCTGCAGGG + Intergenic
1160130782 18:76223172-76223194 CTGGGGAAGGAGCACATGAAAGG - Intergenic
1161063460 19:2226623-2226645 CTGAGCAAGAGGCAGCTGGACGG + Exonic
1163667414 19:18609900-18609922 ATGTGTAAGGGGCAGAAGGAGGG + Intronic
1165137638 19:33679940-33679962 CTGAGTAAGGGGGAGGTGTAAGG + Intronic
1165891886 19:39117551-39117573 TTGAGCAAGGGGGACATGGAGGG + Intergenic
1167246434 19:48375892-48375914 CAGAGGAAGCGGCACCTGGAAGG - Intronic
1168156746 19:54477721-54477743 CTGAGTAGCAGGGACATGGATGG + Intergenic
1168271669 19:55253363-55253385 CTGATTAAAGGGCACAGGCATGG + Intronic
925296019 2:2778048-2778070 CTGAGCATGGGGCACCTGCAAGG - Intergenic
927001124 2:18794817-18794839 TTCAGCATGGGGCACATGGAAGG + Intergenic
928124364 2:28605614-28605636 TTGAATAAGGGGCACTTGTAGGG + Intronic
929971441 2:46580583-46580605 CTGGGTAAGAGGCACAGGGGAGG - Intronic
930754699 2:54962595-54962617 CTGATTGATGGTCACATGGAAGG + Exonic
931586246 2:63832483-63832505 AAGAGCAAGGGGCACAGGGATGG + Intergenic
932448921 2:71797352-71797374 CTGAGTATGGGGCCCATAGAGGG + Intergenic
934311739 2:91873251-91873273 CTGAGAAAAGGGCATATGGGTGG + Intergenic
935542064 2:104360541-104360563 TTGAGTAATGGAAACATGGAGGG + Intergenic
935597116 2:104887586-104887608 CAGAGCAAGAGACACATGGATGG + Intergenic
938408417 2:131045346-131045368 CTGAGGAAGGGGCACAGGTGAGG - Intronic
938803899 2:134788261-134788283 GTGAGTCTGGGGCACCTGGAGGG - Intergenic
941111500 2:161423043-161423065 CTGAGAGAGGGGCACAAGCAAGG - Intronic
942239454 2:173946227-173946249 CTGGGAAAGGGGTACATGGAAGG + Intronic
943081186 2:183260867-183260889 CAGAGTAAGCTGCCCATGGAAGG + Intergenic
944351855 2:198737387-198737409 CTGAGGGAAGGGCACACGGATGG + Intergenic
945947086 2:216004829-216004851 GTGAGTAAGGGACACAGTGAAGG + Intronic
947710537 2:232311609-232311631 AGGAGTGAGGGGCACATGGGAGG - Intronic
947726785 2:232406375-232406397 GTGGGAAAGGGGCACATGGGGGG - Intergenic
947832039 2:233148405-233148427 CTGAGTAAGAGGCACATTGGCGG + Intronic
947909705 2:233792953-233792975 CTGGGTAAGGAGCAGATGGAGGG + Intronic
948533180 2:238626523-238626545 CTGAGAAAGGAGAACAAGGAGGG - Intergenic
1169642941 20:7775925-7775947 TTGACTAATGGGCAAATGGATGG - Intergenic
1169983876 20:11420455-11420477 CTGAACAATGGGCACAGGGAGGG - Intergenic
1170000517 20:11608803-11608825 CAGAGTAAGCTGCACACGGAGGG - Intergenic
1172053773 20:32139897-32139919 CTGAGGAAGGGGTACTTGAAAGG - Intronic
1173264068 20:41461807-41461829 CTGAGGAAGGAGCACATAGCTGG + Intronic
1173745526 20:45433985-45434007 CTGAGTAAAGTGCAGATGGCAGG - Intergenic
1174396225 20:50248345-50248367 CTGGGTGAGGGGCAGATGGGTGG - Intergenic
1175267798 20:57713113-57713135 CTGGGTATGGGGCACAGGGCTGG + Intergenic
1178994651 21:37387722-37387744 CTGAGAAAAGGGTACATGGGAGG + Intronic
1180538489 22:16419068-16419090 CTGAGAAAAGGGCATATGGGTGG + Intergenic
1182792966 22:32968281-32968303 TTGGGTAGGAGGCACATGGAAGG - Intronic
1184307657 22:43617521-43617543 ATGAGGAAGGGGAAAATGGATGG - Intronic
1184640842 22:45869172-45869194 CTGAGTGAATAGCACATGGACGG + Intergenic
1185104100 22:48857665-48857687 CTGAGTATGGAGCTCAGGGATGG - Intergenic
1185104137 22:48857815-48857837 CTGAGTATGGAGCTCAGGGATGG - Intergenic
1185104162 22:48857915-48857937 CTGAGTATGGAGCTCAGGGATGG - Intergenic
950456992 3:13098635-13098657 CTGAGCTAGGGGAAAATGGATGG + Intergenic
950559588 3:13713970-13713992 CTGGGGTGGGGGCACATGGAAGG + Intergenic
952140295 3:30471387-30471409 CTGATTAAGGGACAGTTGGAAGG - Intergenic
953697829 3:45173449-45173471 CTGGGAAAGAGGCACCTGGATGG - Intergenic
953842075 3:46397105-46397127 CTCAGTCAAGGGCGCATGGATGG - Intergenic
953934160 3:47025247-47025269 GTGAGTAAGGGAGTCATGGATGG - Intronic
956160545 3:66346858-66346880 CTGTGTAAGGACCACTTGGATGG + Intronic
957514498 3:81233030-81233052 CTGAGTAAGAGGCATGTTGATGG - Intergenic
958880630 3:99665104-99665126 CTGAGAAATGGCAACATGGAAGG - Intronic
958893884 3:99809045-99809067 CTGAGGAAGAGGCATGTGGAGGG - Intergenic
960621307 3:119639106-119639128 CTGAGTAGGAGGCACATGTCAGG + Intronic
961328474 3:126125460-126125482 CTGAGAGTGGGGCCCATGGAGGG + Intronic
961666722 3:128497429-128497451 CTGAGAGAGGGGCACGGGGAAGG + Intergenic
962320797 3:134388813-134388835 ATCAGGAAGGGGCAAATGGAGGG + Intergenic
962446791 3:135473150-135473172 CTGAGTACCTGGCACATGGTAGG - Intergenic
964212100 3:154239864-154239886 CTGAGTGTGGGACACAAGGATGG + Intronic
969038586 4:4276079-4276101 TTGAGAAAGGGGCTCAGGGAGGG - Intronic
969686805 4:8680035-8680057 TGGTGTAAGGGGCACAAGGAAGG + Intergenic
971453664 4:26823360-26823382 CTGAGGAATAGGTACATGGATGG - Intergenic
976544012 4:86312400-86312422 GTGAGTAAGGAGCACTTGGAAGG - Intronic
979365860 4:119822519-119822541 CTGATATAGGGGCACATGCAAGG - Intergenic
979981335 4:127258913-127258935 GTGAGTAAGGGGATAATGGAAGG - Intergenic
980870003 4:138600456-138600478 GTGAGGAAGGTGCACAAGGATGG + Intergenic
981422784 4:144570560-144570582 CTGGGGAAGGGGTGCATGGATGG + Intergenic
985817861 5:2139786-2139808 CTGAGTAAGCTGCAGATGCAGGG - Intergenic
988173687 5:27692930-27692952 CTGAATAAGAGGCCCATGTATGG - Intergenic
989257699 5:39382946-39382968 CTGAGTAATGGGCCCCTGAATGG - Exonic
991212406 5:64120870-64120892 CTGAGTAAGGTGAAGAGGGAAGG + Intergenic
993842396 5:92895974-92895996 AGGAGTAAAGGGTACATGGAGGG + Intergenic
996817121 5:127586855-127586877 CTTAGCAAGGGGCAGCTGGAGGG - Intergenic
998152782 5:139766487-139766509 CTGTGTATGGGGGAAATGGATGG + Intergenic
1001485593 5:172117462-172117484 CTGGGTAAGGGGCTCAGGGTGGG - Exonic
1001834737 5:174822481-174822503 CAGAGTAAGGAGAACATGGACGG + Intergenic
1001986267 5:176076229-176076251 GTGGGTAAGTGGCACAGGGATGG + Intronic
1002230600 5:177761895-177761917 GTGGGTAAGTGGCACAGGGATGG - Intronic
1002264734 5:178021853-178021875 GTGGGTAAGTGGCACAGGGATGG + Intronic
1003401861 6:5797144-5797166 CTGAGTAATAGGCAAATGGTTGG - Intergenic
1004332679 6:14736032-14736054 CTGAGGACAGAGCACATGGAGGG - Intergenic
1004418295 6:15445222-15445244 GGGAGGAAGGGGCACAGGGAGGG + Intronic
1006662891 6:35663624-35663646 CTGAGGAAAGGGCACATGGGAGG - Intronic
1007944207 6:45810860-45810882 CAGAGAAAGAGGCACAGGGAGGG - Intergenic
1008008679 6:46439911-46439933 CTTTGCAAGGGGCACATGAAAGG - Intronic
1011705407 6:89996194-89996216 TTGGGTAGGGAGCACATGGATGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013677081 6:112477062-112477084 CTCAGGGAGGGGCAAATGGATGG + Intergenic
1014629687 6:123773321-123773343 CAGAGGAAGGGACACATGGAGGG - Intergenic
1015230804 6:130912808-130912830 GTGAGAAAGGGGCAAATGGGTGG + Intronic
1017586884 6:155936320-155936342 ATGAGTAAGTGGCAGAAGGAAGG + Intergenic
1019333779 7:473168-473190 CTCAGAAAGGGGCACAAGGCTGG - Intergenic
1019875656 7:3808311-3808333 TTGAGTGAGGAGCAGATGGAGGG + Intronic
1021303516 7:19002691-19002713 CAGAGTGACAGGCACATGGAAGG - Intergenic
1022285695 7:28955395-28955417 CAGAGTAGGGGACAAATGGATGG - Exonic
1024644751 7:51361805-51361827 CTCACTGAGGGCCACATGGATGG - Intergenic
1024743082 7:52376238-52376260 CTGAGTAAGAGGCGTGTGGATGG + Intergenic
1026953985 7:74365376-74365398 CTGAGTAAGGGGCACATGGATGG - Intronic
1027139549 7:75647560-75647582 CAGAGGAAGGGACACATGAAAGG + Intronic
1029373783 7:100166186-100166208 AAGAGTAAGGGGCACCTGGAGGG + Intronic
1029491057 7:100870362-100870384 CTGGCTCAGGGGCACCTGGAAGG - Exonic
1029911795 7:104159606-104159628 CTGTGTGAGGGGCACAGTGAAGG - Intronic
1033277590 7:139984361-139984383 ATGTGGAAGGGACACATGGAAGG - Intronic
1034845679 7:154442534-154442556 TTGAGGAAAGGGGACATGGAAGG + Intronic
1035104148 7:156428248-156428270 CTGAGAAAGGGTCTCAGGGAGGG + Intergenic
1035433133 7:158837389-158837411 CTGTGGAGGGGCCACATGGAAGG - Intergenic
1039491013 8:37947496-37947518 CTGAGATAGGGGCACAGGGCAGG - Intergenic
1041566559 8:59285164-59285186 CTAAGTAAGATGCACCTGGAAGG - Intergenic
1044842939 8:96353397-96353419 CACAGTACAGGGCACATGGAAGG - Intergenic
1050991114 9:12153469-12153491 CTGACTAAAGGGCACTTGAAAGG - Intergenic
1053434258 9:38065153-38065175 ATGAGTGAGGGGCAGAAGGAAGG + Intronic
1054206127 9:62131476-62131498 CTGAGGAAGAGGCAAAGGGAGGG - Intergenic
1054632231 9:67456891-67456913 CTGAGGAAGAGGCAAAGGGAGGG + Intergenic
1054801465 9:69353931-69353953 CTGGGCAATGGGTACATGGAGGG - Intronic
1057417182 9:94874960-94874982 CTGTGTAAGGGGCTCAAGGATGG + Intronic
1059700499 9:116771307-116771329 CTGAAAAATGGGAACATGGAGGG - Intronic
1060693391 9:125684977-125684999 CAGTGAAATGGGCACATGGAGGG - Intronic
1060891552 9:127192430-127192452 CTTAGGAAAGGGCAGATGGAGGG + Intronic
1061012831 9:127965563-127965585 CTGAGGGAGGGGCAGACGGATGG - Intronic
1061290436 9:129647676-129647698 GTGAGTGAGGGGCCCAGGGAGGG + Intergenic
1061388374 9:130303625-130303647 GTAAGGAAGGGGTACATGGAGGG - Intronic
1061487635 9:130928446-130928468 CTGGGGAAGTTGCACATGGAGGG + Intronic
1062128607 9:134880483-134880505 CTGAGAACGGGGAACAAGGAAGG - Intergenic
1062331677 9:136047646-136047668 CTGAGTACGGGGGAGTTGGAGGG + Intronic
1190282568 X:48940658-48940680 CTGAGTCAAAGCCACATGGAGGG + Intronic
1191786813 X:64925071-64925093 CAGAGTATGTGGCACATGGTGGG + Intronic
1192362556 X:70448847-70448869 TTGACTAAGGGGCAGATGGCTGG + Intronic
1192403340 X:70859141-70859163 CTGAGTGATGGGTAAATGGAGGG + Intronic
1192465594 X:71353398-71353420 CTGAGCAAGTGCCTCATGGAAGG + Intergenic
1192603328 X:72487552-72487574 CTTTGTAAGGGGTACATGTAAGG + Intronic
1196766829 X:119253590-119253612 AAAAGTAAGGGACACATGGAAGG + Intergenic
1197702324 X:129608615-129608637 CTGAGGAAAGCGCACATGGCTGG + Intergenic
1198437405 X:136630560-136630582 CTGAGTGAGGGGCAGAAGGTGGG + Intergenic
1200276137 X:154734662-154734684 CTGAGCAAGGCGCTCAGGGAGGG + Intronic