ID: 1026959350

View in Genome Browser
Species Human (GRCh38)
Location 7:74398660-74398682
Sequence TCTTTATCCCGGAACCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026959350_1026959354 8 Left 1026959350 7:74398660-74398682 CCCTCAGGGTTCCGGGATAAAGA No data
Right 1026959354 7:74398691-74398713 CTGGCCACACACCCAGACTGTGG 0: 1
1: 0
2: 1
3: 26
4: 288
1026959350_1026959359 17 Left 1026959350 7:74398660-74398682 CCCTCAGGGTTCCGGGATAAAGA No data
Right 1026959359 7:74398700-74398722 CACCCAGACTGTGGCTGTGGGGG No data
1026959350_1026959356 14 Left 1026959350 7:74398660-74398682 CCCTCAGGGTTCCGGGATAAAGA No data
Right 1026959356 7:74398697-74398719 ACACACCCAGACTGTGGCTGTGG No data
1026959350_1026959357 15 Left 1026959350 7:74398660-74398682 CCCTCAGGGTTCCGGGATAAAGA No data
Right 1026959357 7:74398698-74398720 CACACCCAGACTGTGGCTGTGGG 0: 1
1: 0
2: 0
3: 20
4: 211
1026959350_1026959358 16 Left 1026959350 7:74398660-74398682 CCCTCAGGGTTCCGGGATAAAGA No data
Right 1026959358 7:74398699-74398721 ACACCCAGACTGTGGCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026959350 Original CRISPR TCTTTATCCCGGAACCCTGA GGG (reversed) Intronic