ID: 1026959480

View in Genome Browser
Species Human (GRCh38)
Location 7:74399239-74399261
Sequence CAGTGTAAGAAGAAGGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026959475_1026959480 1 Left 1026959475 7:74399215-74399237 CCTCATAAGACAGTTGGGTGGGG 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1026959480 7:74399239-74399261 CAGTGTAAGAAGAAGGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026959480 Original CRISPR CAGTGTAAGAAGAAGGGTGC TGG Intronic
No off target data available for this crispr