ID: 1026960360

View in Genome Browser
Species Human (GRCh38)
Location 7:74404020-74404042
Sequence CTGGGCTTGAGGAAGCGTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 170}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026960360_1026960366 11 Left 1026960360 7:74404020-74404042 CCAGGACGCTTCCTCAAGCCCAG 0: 1
1: 0
2: 2
3: 15
4: 170
Right 1026960366 7:74404054-74404076 GAGTGTGAACGGTACAGCCCCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1026960360_1026960368 22 Left 1026960360 7:74404020-74404042 CCAGGACGCTTCCTCAAGCCCAG 0: 1
1: 0
2: 2
3: 15
4: 170
Right 1026960368 7:74404065-74404087 GTACAGCCCCGGCCTGACCCGGG 0: 1
1: 0
2: 0
3: 7
4: 147
1026960360_1026960369 23 Left 1026960360 7:74404020-74404042 CCAGGACGCTTCCTCAAGCCCAG 0: 1
1: 0
2: 2
3: 15
4: 170
Right 1026960369 7:74404066-74404088 TACAGCCCCGGCCTGACCCGGGG 0: 1
1: 0
2: 0
3: 10
4: 98
1026960360_1026960367 21 Left 1026960360 7:74404020-74404042 CCAGGACGCTTCCTCAAGCCCAG 0: 1
1: 0
2: 2
3: 15
4: 170
Right 1026960367 7:74404064-74404086 GGTACAGCCCCGGCCTGACCCGG 0: 1
1: 0
2: 0
3: 9
4: 95
1026960360_1026960365 0 Left 1026960360 7:74404020-74404042 CCAGGACGCTTCCTCAAGCCCAG 0: 1
1: 0
2: 2
3: 15
4: 170
Right 1026960365 7:74404043-74404065 CCTTCTACAGAGAGTGTGAACGG 0: 1
1: 0
2: 1
3: 9
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026960360 Original CRISPR CTGGGCTTGAGGAAGCGTCC TGG (reversed) Exonic
900155778 1:1202786-1202808 CTGGGCTTGGGGATGGGTACTGG - Intergenic
900688700 1:3966198-3966220 CTGGGCTTGGGGTAGTGTCCTGG + Intergenic
900998040 1:6133457-6133479 CTGGGTTTGAGCAAGGGGCCTGG + Intronic
901497463 1:9630134-9630156 CTAGGCTTGAGAATGCCTCCGGG + Intergenic
901666459 1:10828876-10828898 CTGGGCTTGAGGAGACTTGCAGG - Intergenic
903603405 1:24557862-24557884 CTGGGCTTGAGGAACTGGCTGGG + Intronic
909391303 1:75125200-75125222 CTGGCCTTGGGTAGGCGTCCAGG + Intergenic
912934834 1:113993889-113993911 CTGGGCTTGAGAAATAGCCCTGG + Intergenic
914795167 1:150914209-150914231 CTTAGCTTGAGTAAGCCTCCAGG + Intergenic
915390251 1:155536637-155536659 CTGGGCTTGAGCAGTCATCCTGG - Intronic
922784294 1:228275520-228275542 CGGGGCTTAAGGAAGCTTCCTGG + Intronic
924579921 1:245314760-245314782 CAGCTCTTGAGGAAGCGTGCTGG - Intronic
1063454163 10:6171487-6171509 CTGGGCTCAAGGAATCCTCCCGG + Intronic
1063581604 10:7312910-7312932 CTGGGATTGGGGATGCTTCCAGG + Intronic
1067852056 10:49760536-49760558 CTGGGGATGATAAAGCGTCCTGG - Intronic
1069705681 10:70458007-70458029 CTGGGCTGGAGAAATCCTCCAGG - Intergenic
1071517731 10:86310190-86310212 CTGGGCTTGGGGATGGGGCCAGG - Intronic
1071868254 10:89762353-89762375 CTGGGTTTGTGGTAGAGTCCAGG + Intronic
1073009766 10:100349963-100349985 CTGGGCTTCAGGAAACCTACAGG - Intronic
1075389823 10:122084165-122084187 CTGGGCTTGTGGAATCTTCATGG - Exonic
1075726444 10:124613151-124613173 CTTAGCTTGAGGAAACCTCCAGG - Intronic
1076383989 10:130044370-130044392 CTGGGCTGGAGGAGGCGTCATGG - Intergenic
1080563968 11:33491217-33491239 CTGGTCTTGAGGAACCATCAAGG + Intergenic
1081715198 11:45245146-45245168 CTGGGTTTGGGGGAGCGTGCAGG - Intronic
1083622680 11:64056781-64056803 CTGGGCTGAAGGAAGGGTTCTGG + Intronic
1083941555 11:65899217-65899239 CTGGGCTTGTGGGCGCTTCCCGG - Intronic
1084307401 11:68296136-68296158 CTCGGTCTGAGGAAGTGTCCAGG - Intergenic
1084797623 11:71519020-71519042 CCGGGCTTGAGGAACCTGCCCGG + Intronic
1089603260 11:119627653-119627675 GTGGGCATGAGGAAGGGGCCGGG - Intronic
1091194295 11:133718353-133718375 CTGGGCTTGAGAAAGCCTGGTGG - Intergenic
1091194555 11:133720033-133720055 CTGGGCTTGAGAAAGCCTGGTGG - Intergenic
1091569103 12:1669114-1669136 CTGGGCTTCAGGGAGGGCCCTGG + Intergenic
1091992049 12:4963379-4963401 CTGGTCATGAGGATGTGTCCTGG - Intergenic
1096477464 12:51917167-51917189 GTGGGCTTGAGGCAGCATCAGGG + Intronic
1096581074 12:52585708-52585730 CTGGCCTTGGGGAAACATCCTGG + Exonic
1096783014 12:54001599-54001621 CTGGGTGTGAGGAAGTGTCTGGG + Intronic
1097725842 12:63075147-63075169 CTGTGCCTGAGGAAGCTGCCTGG + Intergenic
1098973490 12:76878983-76879005 CTGGGCTGGAGGGAGGGTCCAGG + Exonic
1101285920 12:103312307-103312329 CTGGGCTTGATGAAGCGAGGTGG + Intronic
1101816080 12:108147231-108147253 CTTTGCTTGAGGAAGCTTCCTGG + Intronic
1102206058 12:111091538-111091560 CTGGGCTTTGGGAAGGTTCCAGG - Intronic
1103483075 12:121263885-121263907 CTGGGCTGGATGCAGCCTCCAGG + Exonic
1105864121 13:24443951-24443973 CAGGGCTTGAGGAAGCTACACGG - Intronic
1108238327 13:48432727-48432749 CTATGCTTGAGTAAGCGTACAGG + Intronic
1108710476 13:53028098-53028120 CTGGGTTTGAGGCAGTGCCCTGG + Intergenic
1113517534 13:110914963-110914985 CTGGCCTAGAGGACGCGTCGGGG + Exonic
1114371689 14:22096334-22096356 CTGGGCTTGAGTAACCTTCTGGG - Intergenic
1116160427 14:41260757-41260779 CTGAGCTTTAGGAAGCAACCAGG - Intergenic
1122430248 14:101635689-101635711 CTGGGCTGGAGGAAGCTGTCTGG - Intergenic
1125966713 15:43880773-43880795 CTGGTTTTGAGGAAGTGCCCTGG + Intronic
1127189926 15:56518718-56518740 CAGCGCTTGAGGGAGGGTCCAGG - Intergenic
1129523634 15:76200821-76200843 CTGGGGTTGAGGGAGGGCCCCGG - Intronic
1129881449 15:79009340-79009362 CTGGGCTGGAGGAAGTGCCTGGG + Intronic
1132688894 16:1173650-1173672 CTGGCCTGGTGGAAGCATCCGGG + Intronic
1132977742 16:2719078-2719100 CTGGGAGTGAGGACGTGTCCAGG + Intronic
1133229853 16:4361321-4361343 CTGGGCTTGAGGGAGGGTCCTGG - Intronic
1136554918 16:31001935-31001957 CTGGGCTCCATGAAGGGTCCTGG + Intronic
1137491673 16:48938163-48938185 CTGGGCTTGAGGAGGCAGCAAGG - Intergenic
1138674194 16:58639135-58639157 CTGGCCCTGAGGATGCTTCCAGG + Intergenic
1139364021 16:66422510-66422532 GTGGGCATGAGGAAGTTTCCGGG - Intergenic
1139597754 16:67968214-67968236 CTGGGGTGGAGAAAGCGGCCGGG + Intronic
1141621467 16:85238642-85238664 CTGGGGTAGAGGAAGGCTCCAGG + Intergenic
1141730451 16:85819442-85819464 CTGGGCTGGAGGAAGCTCCAAGG - Intergenic
1142087588 16:88192207-88192229 CTGAGCTGGTGGAAGCGTTCGGG + Intergenic
1144581299 17:16460974-16460996 CTGGTGTTGAGGAAGCCTCGAGG - Intronic
1145907574 17:28524713-28524735 CTGCCCTTGAGGAATCGCCCAGG - Exonic
1146492329 17:33292045-33292067 CGGGCCATGCGGAAGCGTCCCGG + Exonic
1148492626 17:48033124-48033146 CTGGGCTTGAGGCTGGGACCTGG - Intronic
1149502619 17:57165715-57165737 CTGGGCTTCAGGTTGGGTCCAGG - Intergenic
1149698824 17:58638278-58638300 CTGGGCTCAAGCAAGTGTCCCGG - Intronic
1151550217 17:74818373-74818395 CTGGGCTAGAGAAGGCGACCTGG - Intronic
1151936845 17:77267077-77267099 CAGGGCTTGAGGCTGCGCCCTGG + Intergenic
1153712968 18:7818973-7818995 TTAGGCTTGAGGAAGCTTCCTGG + Intronic
1157557307 18:48621357-48621379 CTGGGCTGGAAGAAGAGTCCGGG + Intronic
1160348328 18:78152990-78153012 CTGGGGATAAGGAAGGGTCCTGG - Intergenic
1160722224 19:602819-602841 TTGGGCCTGAGGAAGGGACCTGG + Intronic
1164752823 19:30669081-30669103 CTGGGCTCTAGGAAGCCTCCAGG - Intronic
1165494294 19:36142586-36142608 CTGGGTTTGGGGAGCCGTCCTGG + Intronic
1165951227 19:39474824-39474846 CTGGGATTGAGGAAGCCTAGAGG + Intronic
1167523752 19:49971596-49971618 CTGGGCAAAGGGAAGCGTCCTGG - Intergenic
1168051232 19:53831360-53831382 CTGGGCTCGAGCAATCCTCCTGG - Intergenic
924977759 2:193523-193545 CGGGGCTTCTGGAAGCCTCCAGG - Intergenic
926026477 2:9549619-9549641 CTGGGCATGAGCAATCCTCCGGG + Intronic
927961480 2:27242981-27243003 CTGGGCTTGAGGAAGAAGCCAGG + Intronic
928205405 2:29280063-29280085 CTGGGACTGAGCAAGAGTCCTGG + Intronic
928241571 2:29591369-29591391 CTTGGCTTTTGGAAGCATCCGGG + Intronic
929784687 2:44980783-44980805 CTGTGCTTGAATAAGCCTCCAGG + Intergenic
929784877 2:44982235-44982257 CTGTGCTTGAATAAGCCTCCAGG - Intergenic
929816594 2:45237666-45237688 CTGGGCTAGAGCAAGCCCCCTGG - Intergenic
932573390 2:72950037-72950059 CTGGGCAGGAGAAAGCGCCCGGG + Intronic
933177288 2:79189794-79189816 CAGTACTTGAGGAAGGGTCCTGG + Intronic
934713370 2:96529597-96529619 CTGGCCTGGAGGAACCTTCCCGG - Intergenic
937200800 2:120203548-120203570 CTAGGCTGCAGGAAGCCTCCAGG + Intergenic
937445382 2:121952973-121952995 CTGGGCCTAAGGATGCCTCCAGG - Intergenic
943659476 2:190543109-190543131 CTGGGCTTAAGGCACCATCCAGG - Intergenic
947660409 2:231862257-231862279 CTGTGGTTGAAGAAGCCTCCTGG + Intergenic
1169164167 20:3407875-3407897 CCGGGCTTGAGGACGAGGCCGGG - Intergenic
1171849973 20:30301182-30301204 CTGGGGGTGAGGGAGCTTCCTGG - Intergenic
1175416435 20:58804368-58804390 ATGTGCAGGAGGAAGCGTCCTGG + Intergenic
1176243548 20:64086030-64086052 CTTGGCTTGAGGAAGGTCCCTGG + Intronic
1178901499 21:36602624-36602646 ACGGGCTTTAGGAAGCGCCCAGG - Intergenic
1180634704 22:17255038-17255060 CTGGGCTTAGGCAAGCCTCCTGG - Intergenic
1180722501 22:17920022-17920044 CTGGGCTTGTGGCAGCTTCGTGG - Intronic
1180859649 22:19070454-19070476 CTTGGCTTGGGGAAGAGGCCAGG - Intronic
1181260172 22:21591750-21591772 CTGGGCCAGAGGAAGCAGCCTGG + Intronic
1181483820 22:23218289-23218311 CTGGGCGTGAGGCACTGTCCCGG - Intronic
1181978862 22:26752202-26752224 GTGTGCTTGAGGAAGAGACCTGG + Intergenic
1182022404 22:27091762-27091784 ATGGGCTTGTGGCATCGTCCTGG + Intergenic
1184421320 22:44384442-44384464 CTGGGCTAGAGGAAGAGCCAGGG + Intergenic
1184947743 22:47816084-47816106 CTGGCCTTCAGGCAACGTCCAGG - Intergenic
1185174963 22:49321239-49321261 CTGGGACAGAGGCAGCGTCCGGG - Intergenic
950101148 3:10357749-10357771 ATGGGCATGAGGCAGCGTGCAGG - Intronic
950478301 3:13227914-13227936 CTGGGGTGGAGGCAGCATCCAGG - Intergenic
954138590 3:48593749-48593771 CTGGCCTTGAGGAGGCCTCTAGG + Intronic
954705338 3:52477471-52477493 ATGGTCGGGAGGAAGCGTCCTGG + Intronic
960608368 3:119531575-119531597 CTGGGCTGGAGAGAGGGTCCAGG + Intronic
960944695 3:122958130-122958152 CTGGGCTGGGGGAAGCTGCCAGG - Intronic
961386401 3:126525474-126525496 ATGGGCTTGGGGAGGCATCCAGG - Intronic
961967345 3:130919165-130919187 CTGGGCTGGAGGGAGTGTCCAGG + Intronic
963078109 3:141366971-141366993 CTGGGCCTGAGGAAGAGTCCTGG - Intronic
963622898 3:147634747-147634769 CTGGGCTTGAGCTAGGGACCTGG - Intergenic
964681570 3:159345792-159345814 CTGGGCCTGAGGATGTGTCTTGG + Intronic
966752502 3:183335763-183335785 CTGGGCTTGAGCGATCATCCTGG - Intronic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
968699464 4:2047732-2047754 CTGGGCTCCAGGAAGCAGCCTGG - Intergenic
968940225 4:3633812-3633834 CTGGGTCTGAGGCTGCGTCCTGG + Intergenic
971093889 4:23375922-23375944 CTGGGATGGAGAAAGAGTCCTGG - Intergenic
971327451 4:25655848-25655870 CTGGGCTGGAGGCGGCGGCCAGG - Exonic
971379482 4:26083804-26083826 CTGGGCTTCCTGAAGCCTCCTGG + Intergenic
972607632 4:40629022-40629044 GTGAGACTGAGGAAGCGTCCTGG - Intronic
975459407 4:74632969-74632991 CTGGGCTTGATGAAGCCTGCTGG - Intergenic
977251215 4:94691744-94691766 CAGGGCTGGAGGAAGGGTCACGG - Intergenic
985537651 5:473801-473823 CTGAGCTGGAGGCAGAGTCCGGG + Intronic
985569441 5:636866-636888 TTGGGCATGAGCAAGCTTCCAGG - Intronic
986884290 5:12214977-12214999 ATGGGCTCGAGGAAACTTCCAGG + Intergenic
990500886 5:56396293-56396315 AGAGGCTTGAGGAAGCCTCCTGG - Intergenic
991298258 5:65103350-65103372 CGGGGCCTGAGGAAGCTGCCCGG - Intergenic
992484315 5:77180544-77180566 CTGGGCTTGTGCCAGCGGCCGGG - Intergenic
992649444 5:78843306-78843328 CATGGTTTGAGGAAGCCTCCCGG + Intronic
996094484 5:119383859-119383881 CTGGGCTTGAAATAGCTTCCAGG - Intronic
996308863 5:122080063-122080085 CTGGGCTTAAGGAATTCTCCGGG - Intergenic
996846005 5:127899668-127899690 GTGGGCTTGGGGAAGCCTCATGG + Intergenic
997779117 5:136639342-136639364 CTGGTTTTGTGGAAGCATCCTGG + Intergenic
997985592 5:138499084-138499106 ATGGGGTTCAGGAAGCTTCCAGG - Intergenic
998353844 5:141518187-141518209 CTGGGGATGATGAAACGTCCTGG + Intronic
998513899 5:142735935-142735957 CTGGGATTGAGGAAAGGACCAGG - Intergenic
998590356 5:143471547-143471569 CTGGGCTTTAGGAAGGGCCAGGG + Intergenic
999200977 5:149816025-149816047 CAGGGCCTGTGGAAGCCTCCCGG + Intronic
1002187242 5:177460068-177460090 CCGGGCCTGAGGGAGCCTCCCGG - Intronic
1003208768 6:4039989-4040011 CTGGGCTCAAGGAATCCTCCCGG + Intronic
1005275710 6:24215418-24215440 ATGGGGCTGAGGGAGCGTCCTGG + Intronic
1006166843 6:32070305-32070327 CTGGCCCTCAGGAACCGTCCAGG + Intronic
1007111358 6:39314956-39314978 CTGGAGTGGAGGAAGCGTCTAGG + Exonic
1007139312 6:39555216-39555238 CTGGGCTTGGGGAGGGCTCCAGG - Intronic
1007177527 6:39906957-39906979 CTGGGCTAGAGGAGGGGTCTGGG + Exonic
1008640573 6:53458360-53458382 CTGGGATGGAGGAGGCATCCAGG - Intergenic
1017614546 6:156230443-156230465 CTGAGCTTCAGGATGAGTCCAGG - Intergenic
1017982267 6:159410569-159410591 CTGAGGTTGAGGATGCGTCCAGG + Intergenic
1020800481 7:12726739-12726761 CTGGGCTTGAGGAGGGGTTGGGG - Intergenic
1022132899 7:27420535-27420557 TTGGGCTTGAGGGATCCTCCAGG - Intergenic
1026960360 7:74404020-74404042 CTGGGCTTGAGGAAGCGTCCTGG - Exonic
1027181706 7:75945204-75945226 CTGGGCTTGAGGGATCCTCCGGG - Intronic
1027202957 7:76074365-76074387 CTGGGCTTGTGGAGGCTGCCCGG + Intergenic
1027446514 7:78279924-78279946 CTGGGTTTGAGGATGCCTGCAGG - Intronic
1029866065 7:103630499-103630521 ATGGGAATGAGGAAGTGTCCTGG - Intronic
1032858750 7:135858580-135858602 CTGGGCCTGGGCCAGCGTCCAGG + Intergenic
1045861031 8:106815189-106815211 CTGGGCCTGAGCAAGTGGCCTGG + Intergenic
1048194741 8:132323068-132323090 TTGGGGTGGAGGAAGCTTCCCGG - Intronic
1050002230 9:1089765-1089787 CTGGGCTTTGGAAAGAGTCCTGG - Intergenic
1053073044 9:35112090-35112112 CTGGCATGGAGGAAGCTTCCTGG - Intronic
1053787748 9:41664475-41664497 CTGGGGGTGAGGGAGCTTCCTGG - Intergenic
1054157378 9:61650292-61650314 CTGGGGGTGAGGGAGCTTCCTGG + Intergenic
1054176024 9:61875817-61875839 CTGGGGGTGAGGGAGCTTCCTGG - Intergenic
1054477152 9:65581297-65581319 CTGGGGGTGAGGGAGCTTCCTGG + Intergenic
1054661515 9:67704991-67705013 CTGGGGGTGAGGGAGCTTCCTGG + Intergenic
1058835820 9:108857762-108857784 CTGGGCCTGAGGAAGTTTTCTGG + Intergenic
1059561066 9:115334925-115334947 CTGGGCCAGAGGAAGAGGCCAGG - Intronic
1059584995 9:115596407-115596429 TTGTGCTAGAGGAAGCGTGCTGG - Intergenic
1062323726 9:136002954-136002976 CTGGTCTCCAGGAAGGGTCCTGG + Intergenic
1185644645 X:1608417-1608439 CGGGGCTTGAGGACGCCACCAGG - Intergenic
1189601340 X:42630009-42630031 CTGGGCTATAAGAAGCCTCCTGG - Intergenic
1190692595 X:52923968-52923990 CTGGGCTTGCAGCAGCATCCAGG + Intergenic
1190794296 X:53726506-53726528 GAGGGCTTCAGGAAGCTTCCAGG - Intergenic
1191786240 X:64919671-64919693 CTGGTCTTCAGGAAGTGGCCTGG - Intronic
1191867712 X:65718722-65718744 CTGGGCTTGAGCAACCCTCCTGG - Intronic
1193944747 X:87721795-87721817 GTGGGCTTGGGGAAGCTTCCTGG - Intergenic
1197660838 X:129169440-129169462 CTGTGCTTTAGGAAGCATTCTGG - Intergenic
1200070759 X:153527910-153527932 CTGGGCTTGAAGGAACCTCCGGG + Intronic