ID: 1026962601

View in Genome Browser
Species Human (GRCh38)
Location 7:74418064-74418086
Sequence GTGTAAATTCAGAAGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026962592_1026962601 28 Left 1026962592 7:74418013-74418035 CCACTCCCCAAGAGAGGCTGGGA No data
Right 1026962601 7:74418064-74418086 GTGTAAATTCAGAAGGAACATGG No data
1026962594_1026962601 22 Left 1026962594 7:74418019-74418041 CCCAAGAGAGGCTGGGAAGTGTT No data
Right 1026962601 7:74418064-74418086 GTGTAAATTCAGAAGGAACATGG No data
1026962593_1026962601 23 Left 1026962593 7:74418018-74418040 CCCCAAGAGAGGCTGGGAAGTGT No data
Right 1026962601 7:74418064-74418086 GTGTAAATTCAGAAGGAACATGG No data
1026962595_1026962601 21 Left 1026962595 7:74418020-74418042 CCAAGAGAGGCTGGGAAGTGTTT No data
Right 1026962601 7:74418064-74418086 GTGTAAATTCAGAAGGAACATGG No data
1026962590_1026962601 29 Left 1026962590 7:74418012-74418034 CCCACTCCCCAAGAGAGGCTGGG No data
Right 1026962601 7:74418064-74418086 GTGTAAATTCAGAAGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026962601 Original CRISPR GTGTAAATTCAGAAGGAACA TGG Intergenic
No off target data available for this crispr