ID: 1026963790

View in Genome Browser
Species Human (GRCh38)
Location 7:74426465-74426487
Sequence ACGGAGGCCCAGAGAGGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026963785_1026963790 -1 Left 1026963785 7:74426443-74426465 CCCTTAATTCACTGATAGGGAAA No data
Right 1026963790 7:74426465-74426487 ACGGAGGCCCAGAGAGGCAAAGG No data
1026963786_1026963790 -2 Left 1026963786 7:74426444-74426466 CCTTAATTCACTGATAGGGAAAC No data
Right 1026963790 7:74426465-74426487 ACGGAGGCCCAGAGAGGCAAAGG No data
1026963780_1026963790 5 Left 1026963780 7:74426437-74426459 CCAGCCCCCTTAATTCACTGATA No data
Right 1026963790 7:74426465-74426487 ACGGAGGCCCAGAGAGGCAAAGG No data
1026963784_1026963790 0 Left 1026963784 7:74426442-74426464 CCCCTTAATTCACTGATAGGGAA No data
Right 1026963790 7:74426465-74426487 ACGGAGGCCCAGAGAGGCAAAGG No data
1026963778_1026963790 9 Left 1026963778 7:74426433-74426455 CCACCCAGCCCCCTTAATTCACT No data
Right 1026963790 7:74426465-74426487 ACGGAGGCCCAGAGAGGCAAAGG No data
1026963783_1026963790 1 Left 1026963783 7:74426441-74426463 CCCCCTTAATTCACTGATAGGGA No data
Right 1026963790 7:74426465-74426487 ACGGAGGCCCAGAGAGGCAAAGG No data
1026963779_1026963790 6 Left 1026963779 7:74426436-74426458 CCCAGCCCCCTTAATTCACTGAT No data
Right 1026963790 7:74426465-74426487 ACGGAGGCCCAGAGAGGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026963790 Original CRISPR ACGGAGGCCCAGAGAGGCAA AGG Intergenic
No off target data available for this crispr