ID: 1026967695

View in Genome Browser
Species Human (GRCh38)
Location 7:74450848-74450870
Sequence CTTCTCATTGGACCACAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026967695_1026967699 -10 Left 1026967695 7:74450848-74450870 CCACACTGTGGTCCAATGAGAAG No data
Right 1026967699 7:74450861-74450883 CAATGAGAAGCTGCAGGAGGAGG No data
1026967695_1026967702 10 Left 1026967695 7:74450848-74450870 CCACACTGTGGTCCAATGAGAAG No data
Right 1026967702 7:74450881-74450903 AGGGAAGTGGAGACTCACAGAGG No data
1026967695_1026967701 -3 Left 1026967695 7:74450848-74450870 CCACACTGTGGTCCAATGAGAAG No data
Right 1026967701 7:74450868-74450890 AAGCTGCAGGAGGAGGGAAGTGG No data
1026967695_1026967700 -9 Left 1026967695 7:74450848-74450870 CCACACTGTGGTCCAATGAGAAG No data
Right 1026967700 7:74450862-74450884 AATGAGAAGCTGCAGGAGGAGGG No data
1026967695_1026967703 29 Left 1026967695 7:74450848-74450870 CCACACTGTGGTCCAATGAGAAG No data
Right 1026967703 7:74450900-74450922 GAGGAAAACTGACTTGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026967695 Original CRISPR CTTCTCATTGGACCACAGTG TGG (reversed) Intergenic
No off target data available for this crispr