ID: 1026969747

View in Genome Browser
Species Human (GRCh38)
Location 7:74460822-74460844
Sequence CGGGGTCTCCCAGCTTTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 101}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026969747_1026969760 5 Left 1026969747 7:74460822-74460844 CCTTTCAAAGCTGGGAGACCCCG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1026969760 7:74460850-74460872 GGGGCGGTTGTGGACTTGAGGGG 0: 1
1: 0
2: 0
3: 4
4: 120
1026969747_1026969762 25 Left 1026969747 7:74460822-74460844 CCTTTCAAAGCTGGGAGACCCCG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1026969762 7:74460870-74460892 GGGCTGACCCCACAGCACGGAGG No data
1026969747_1026969759 4 Left 1026969747 7:74460822-74460844 CCTTTCAAAGCTGGGAGACCCCG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1026969759 7:74460849-74460871 GGGGGCGGTTGTGGACTTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 163
1026969747_1026969758 3 Left 1026969747 7:74460822-74460844 CCTTTCAAAGCTGGGAGACCCCG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1026969758 7:74460848-74460870 CGGGGGCGGTTGTGGACTTGAGG No data
1026969747_1026969754 -5 Left 1026969747 7:74460822-74460844 CCTTTCAAAGCTGGGAGACCCCG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1026969754 7:74460840-74460862 CCCCGCCACGGGGGCGGTTGTGG No data
1026969747_1026969761 22 Left 1026969747 7:74460822-74460844 CCTTTCAAAGCTGGGAGACCCCG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1026969761 7:74460867-74460889 GAGGGGCTGACCCCACAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026969747 Original CRISPR CGGGGTCTCCCAGCTTTGAA AGG (reversed) Intronic