ID: 1026969754

View in Genome Browser
Species Human (GRCh38)
Location 7:74460840-74460862
Sequence CCCCGCCACGGGGGCGGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026969743_1026969754 27 Left 1026969743 7:74460790-74460812 CCTGAGTGCTGGGAAAGTGTCTG 0: 1
1: 0
2: 1
3: 30
4: 269
Right 1026969754 7:74460840-74460862 CCCCGCCACGGGGGCGGTTGTGG No data
1026969747_1026969754 -5 Left 1026969747 7:74460822-74460844 CCTTTCAAAGCTGGGAGACCCCG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1026969754 7:74460840-74460862 CCCCGCCACGGGGGCGGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026969754 Original CRISPR CCCCGCCACGGGGGCGGTTG TGG Intronic