ID: 1026969759 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:74460849-74460871 |
Sequence | GGGGGCGGTTGTGGACTTGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 169 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 163} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1026969747_1026969759 | 4 | Left | 1026969747 | 7:74460822-74460844 | CCTTTCAAAGCTGGGAGACCCCG | 0: 1 1: 0 2: 0 3: 5 4: 101 |
||
Right | 1026969759 | 7:74460849-74460871 | GGGGGCGGTTGTGGACTTGAGGG | 0: 1 1: 0 2: 0 3: 5 4: 163 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1026969759 | Original CRISPR | GGGGGCGGTTGTGGACTTGA GGG | Intronic | ||