ID: 1026969761

View in Genome Browser
Species Human (GRCh38)
Location 7:74460867-74460889
Sequence GAGGGGCTGACCCCACAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026969755_1026969761 3 Left 1026969755 7:74460841-74460863 CCCGCCACGGGGGCGGTTGTGGA 0: 1
1: 0
2: 0
3: 4
4: 99
Right 1026969761 7:74460867-74460889 GAGGGGCTGACCCCACAGCACGG No data
1026969753_1026969761 4 Left 1026969753 7:74460840-74460862 CCCCGCCACGGGGGCGGTTGTGG No data
Right 1026969761 7:74460867-74460889 GAGGGGCTGACCCCACAGCACGG No data
1026969756_1026969761 2 Left 1026969756 7:74460842-74460864 CCGCCACGGGGGCGGTTGTGGAC No data
Right 1026969761 7:74460867-74460889 GAGGGGCTGACCCCACAGCACGG No data
1026969757_1026969761 -1 Left 1026969757 7:74460845-74460867 CCACGGGGGCGGTTGTGGACTTG No data
Right 1026969761 7:74460867-74460889 GAGGGGCTGACCCCACAGCACGG No data
1026969747_1026969761 22 Left 1026969747 7:74460822-74460844 CCTTTCAAAGCTGGGAGACCCCG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1026969761 7:74460867-74460889 GAGGGGCTGACCCCACAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026969761 Original CRISPR GAGGGGCTGACCCCACAGCA CGG Intronic