ID: 1026970217

View in Genome Browser
Species Human (GRCh38)
Location 7:74463119-74463141
Sequence CTGAGGGTAGGGAAGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1434
Summary {0: 1, 1: 0, 2: 6, 3: 147, 4: 1280}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026970210_1026970217 -2 Left 1026970210 7:74463098-74463120 CCTGAAATAAGAGCAGGACTTCT 0: 1
1: 0
2: 0
3: 15
4: 168
Right 1026970217 7:74463119-74463141 CTGAGGGTAGGGAAGGAAGGTGG 0: 1
1: 0
2: 6
3: 147
4: 1280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026970217 Original CRISPR CTGAGGGTAGGGAAGGAAGG TGG Intronic
900015081 1:142777-142799 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900016684 1:155599-155621 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900045348 1:501386-501408 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900046945 1:514191-514213 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900067545 1:743116-743138 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900069148 1:755909-755931 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900143566 1:1148604-1148626 CTGATGGTGTGGAAGGAATGAGG + Intergenic
900146283 1:1160257-1160279 AGGAGGGAAGGGAAGGAAGGAGG + Intergenic
900292500 1:1929405-1929427 GTGAGGGTAGGGAGGGAGCGAGG + Intronic
900650747 1:3729053-3729075 CTGTTGGTAGGGGAGGAAGAGGG + Intronic
900681722 1:3920268-3920290 GGGAGGGAAGGGAGGGAAGGAGG - Intergenic
900803852 1:4754840-4754862 ATGAGGGGAGAGCAGGAAGGAGG - Intronic
900941569 1:5801861-5801883 CTGGGGTTAGGGGAGGGAGGTGG + Intergenic
901004084 1:6163335-6163357 CTCAGGGCAGGGGAGGCAGGTGG - Intronic
901061812 1:6475216-6475238 AGGAGGGTTGGGAAGGAGGGTGG - Intronic
901061828 1:6475253-6475275 AGGAGGGTTGGGAAGGAGGGTGG - Intronic
901215479 1:7552532-7552554 CCGACAGGAGGGAAGGAAGGAGG + Intronic
901395582 1:8978725-8978747 CTGAGGGTGGCGTGGGAAGGTGG + Intergenic
901519135 1:9769150-9769172 AGGAAGGGAGGGAAGGAAGGAGG + Intronic
901681584 1:10915923-10915945 CTGAGGGTTGGGAAGCAAAAGGG - Intergenic
902107056 1:14046707-14046729 CTGAGTGCAGGTAAGGAAGAGGG - Intergenic
902108513 1:14058246-14058268 CTAAAGGTAAAGAAGGAAGGAGG - Intergenic
902201848 1:14839293-14839315 TTGAGGCCAGGGAAGGTAGGGGG - Intronic
902283006 1:15388242-15388264 GGGAGGGAAGGGAAGGAGGGAGG - Intronic
902283024 1:15388287-15388309 GGGAGGGAAGGGAAGGAGGGAGG - Intronic
902364078 1:15959482-15959504 AGGAGGGAAGGGAAGGAAGAGGG + Intronic
902538383 1:17135158-17135180 CGGGGGGTTGGGAAGGATGGAGG - Intergenic
902539095 1:17139805-17139827 ATGTGGGTGGGGAAGGCAGGGGG + Intergenic
902606804 1:17573563-17573585 CTGGGGGCTGGGAGGGAAGGAGG + Intronic
902762019 1:18587440-18587462 ATGAGGGCAGGGAAAGGAGGTGG + Intergenic
902873116 1:19326023-19326045 CTGAGGGCAGGGAGGTCAGGAGG - Intronic
903035556 1:20490455-20490477 AGGAGGGTAGGGAAGGGAAGTGG - Intergenic
903187026 1:21634565-21634587 CAGAGGGATGGGCAGGAAGGTGG + Intronic
904146230 1:28394278-28394300 CGGAGGGAAGGAAAGGAGGGAGG + Intronic
904212916 1:28897583-28897605 CGGAGGGAAGGGAAGGGAAGGGG + Intronic
904307467 1:29599350-29599372 CTGAGGGCAGGTGAGGAGGGTGG + Intergenic
904396278 1:30224596-30224618 CTGAGGGCAGGCGAGGAGGGTGG - Intergenic
904441656 1:30535722-30535744 GTGAGGGTGGGGAAGGGAGAGGG + Intergenic
904616548 1:31753169-31753191 CTGAGGTCAGGGCTGGAAGGCGG - Intronic
904871020 1:33618291-33618313 CTTGGGGTAGGGGATGAAGGAGG - Intronic
905094411 1:35456861-35456883 AGGAAGGGAGGGAAGGAAGGAGG + Intronic
905122949 1:35695727-35695749 CAGTGGGGAGGGAAGAAAGGAGG + Intergenic
905309126 1:37037409-37037431 GGGAGGGGAGGGGAGGAAGGGGG - Intergenic
905415711 1:37802534-37802556 AAGAGGGAAGGGGAGGAAGGAGG + Intergenic
905573042 1:39021223-39021245 CAGAGAGAATGGAAGGAAGGAGG - Intergenic
905587552 1:39132757-39132779 GTGGGGGGTGGGAAGGAAGGAGG + Intronic
905858500 1:41330656-41330678 CTGAGGGCAGGGCAGGGAGGTGG - Intergenic
906155728 1:43612950-43612972 GGGAGGGTAGGGAAGGAAAAAGG - Intronic
906197714 1:43939253-43939275 AGGAGGGGAGGGAAGGAAGGAGG + Intergenic
906197731 1:43939287-43939309 GGGAGGGGAGGGAGGGAAGGAGG + Intergenic
906300428 1:44677709-44677731 TTGAGGGGAGGGAAGGGAAGAGG + Intronic
906348690 1:45038463-45038485 CAAAGGGTAGGAAAGGAAGGTGG + Intronic
906954955 1:50366483-50366505 CGAAGGGAAGGGAAGGAGGGAGG - Intergenic
907076346 1:51582659-51582681 GTGAGTGTAGAGAAGGAGGGAGG - Intronic
907110167 1:51919897-51919919 ATGAGGGGAGGTCAGGAAGGTGG + Exonic
907437427 1:54458757-54458779 CAGGAGGGAGGGAAGGAAGGAGG + Intergenic
907621317 1:55983532-55983554 CAGAGGGGAGGGGAGTAAGGGGG + Intergenic
909016806 1:70388965-70388987 AGGAAGGGAGGGAAGGAAGGAGG - Intergenic
909503270 1:76359050-76359072 CTGAGAGTAGGGTAGGAAGAAGG + Intronic
909520973 1:76567035-76567057 ATGAGGACAGGGAAGGAGGGAGG + Intronic
909959566 1:81823355-81823377 GAGGGGGGAGGGAAGGAAGGAGG - Intronic
910310684 1:85820605-85820627 CAGATGGTAGGGAAGGCAGGTGG - Intronic
910772526 1:90844377-90844399 CTATGGGGAGGGTAGGAAGGAGG - Intergenic
911088787 1:94001256-94001278 TGTAGGGTAGGGAAGGCAGGAGG + Intronic
911968529 1:104399213-104399235 CTGAGGATAGGGAGAGAAGCAGG + Intergenic
912746479 1:112249531-112249553 CTGAGGGTGGGGGTGGAGGGTGG - Intergenic
913108862 1:115640618-115640640 CTGGGGGTGGGGGAGGAAGATGG + Intergenic
913355745 1:117919886-117919908 GGGAGGGAAGGGCAGGAAGGAGG + Intronic
913382158 1:118224258-118224280 CTGAGGGTGGTGGAGGAATGGGG + Intergenic
913498479 1:119449500-119449522 CTGAGGGCAAAGAAGGAAGAAGG - Intergenic
913509512 1:119549153-119549175 CTGAGGGCAATGAAGGAAGCAGG - Intergenic
913513323 1:119581983-119582005 CTGAGGTCAATGAAGGAAGGAGG - Intergenic
913516950 1:119612968-119612990 CTGAGGTCAGTGAAGGAAGCAGG - Intergenic
913583961 1:120254796-120254818 GGGAGGGGAGGGAAGGAAGGAGG + Intergenic
913601079 1:120421531-120421553 ATGGAGGGAGGGAAGGAAGGAGG - Intergenic
913624220 1:120643544-120643566 GGGAGGGGAGGGAAGGAAGGAGG - Intergenic
913995756 1:143651147-143651169 TTGGGGGTGGGGAAGGAGGGAGG + Intergenic
914085966 1:144455070-144455092 ATGGAGGGAGGGAAGGAAGGAGG + Intronic
914191863 1:145419050-145419072 ATGGAGGGAGGGAAGGAAGGAGG + Intergenic
914565948 1:148866640-148866662 GGGAGGGGAGGGAAGGAAGGAGG + Intronic
914589788 1:149097051-149097073 ATGGAGGGAGGGAAGGAAGGAGG + Intronic
914666327 1:149835824-149835846 CTGAGGTTAAGGAAGGGAAGGGG + Intergenic
914669440 1:149857974-149857996 CTGAGGTTAAGGAAGGGAAGGGG - Intronic
914684504 1:149966332-149966354 CTGAGTGGAGGGAAGGAATCAGG - Intronic
914985897 1:152457024-152457046 GAGAGGGTATGGCAGGAAGGAGG + Intergenic
915128480 1:153681359-153681381 CTGGGAATAGGGAAGGATGGAGG - Intronic
915463006 1:156081040-156081062 CTGAGTGTAGGAATGGAAGGGGG - Intronic
915480048 1:156178270-156178292 CAGAGGGTAGAGGAGGAAGGTGG - Intergenic
915737402 1:158093786-158093808 CAGAGGGTGGAGAAGGCAGGAGG - Intronic
915782472 1:158567975-158567997 CTGAGGGGTGGGCAGGAGGGAGG - Intergenic
915895343 1:159807576-159807598 CTGAGGGTAGAGATGGAGGCTGG + Intronic
916527020 1:165619967-165619989 ATGAAGGGAGGGAAGGAGGGAGG - Intergenic
916654703 1:166864430-166864452 CCTAGGCTAGGCAAGGAAGGTGG + Intronic
916670803 1:167018344-167018366 CGGCAGGGAGGGAAGGAAGGTGG - Intronic
916742383 1:167657602-167657624 CAGAGGGGAGGGGAGGAAGGAGG - Intronic
917014193 1:170511190-170511212 CGGAGGGCAGGGAACAAAGGGGG - Intergenic
917135251 1:171782884-171782906 CTGGAGGTAGGGAAGGAGGAAGG + Intronic
917521749 1:175753508-175753530 CTCGGGGAGGGGAAGGAAGGAGG - Intergenic
918146454 1:181760246-181760268 ATGGGGGTAGGGTGGGAAGGAGG - Intronic
918177999 1:182061867-182061889 CTGAGAGGAGGGAAGGAGGAAGG - Intergenic
918214615 1:182382608-182382630 CTCAGGGGAGCAAAGGAAGGGGG + Exonic
918481813 1:184986184-184986206 CTGTGGTTAGGGAAGAAAGGAGG + Intergenic
918642781 1:186863640-186863662 CAGAGGCTAGGGAAGATAGGAGG - Intronic
919441186 1:197635030-197635052 AGGAAGGAAGGGAAGGAAGGAGG + Intronic
919470588 1:197974292-197974314 CTGAGGGCAGGGAAAGTAGAAGG + Intergenic
919739938 1:200975313-200975335 CCGCGGGTAGGGAAGAAGGGAGG + Intronic
919846103 1:201643198-201643220 GAGAAGGAAGGGAAGGAAGGAGG - Intronic
920081208 1:203374055-203374077 CTCAGGGGAGGGAAAGGAGGAGG + Intergenic
920347966 1:205318839-205318861 CTGAGGGAAGGGCAGGTGGGCGG - Intronic
920351280 1:205339592-205339614 CTGAGCCAAGGGAAGGAAGGAGG + Intronic
920370004 1:205472950-205472972 CTGAGGTGAGTGGAGGAAGGAGG + Intergenic
920626842 1:207611065-207611087 GTGAGGGTAGGGAGGGGAGGTGG - Intronic
920984649 1:210875008-210875030 TTGAAGGGAAGGAAGGAAGGAGG + Intronic
921148310 1:212379787-212379809 GTGAGGGCAGGGAAGGGAAGGGG - Intronic
921165911 1:212506999-212507021 CTGAGAGTGGGGAAGGTAGGAGG - Intergenic
921308142 1:213817306-213817328 CAGAGGCCAGAGAAGGAAGGCGG + Intergenic
921442390 1:215202999-215203021 AAGAGGGAAGGGAAGGAGGGAGG - Intronic
921707862 1:218345158-218345180 CTGTGGGTAAGGGAGGAAGGAGG - Intergenic
921946039 1:220886865-220886887 CGGAGTCTAGGGAAGAAAGGTGG + Intergenic
922102148 1:222485889-222485911 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
922104509 1:222501301-222501323 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
922263231 1:223961000-223961022 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
922264827 1:223973814-223973836 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
922875932 1:228939965-228939987 CAGAGGACAGGGAAGGAAAGAGG + Intergenic
922968251 1:229710711-229710733 CTGAGAGAAGGGAAGCAGGGAGG + Intergenic
923145796 1:231196888-231196910 CTGAGGGATGGACAGGAAGGGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923556691 1:235006520-235006542 GTGAGGGTGGGGAAAGAATGGGG + Intergenic
923683650 1:236139738-236139760 GGGAAGGAAGGGAAGGAAGGAGG - Intergenic
923731113 1:236551169-236551191 CTGTGGGCAAGGAATGAAGGCGG - Exonic
924116529 1:240753177-240753199 CAGAAGGGAGGGAGGGAAGGAGG - Intergenic
924345071 1:243066009-243066031 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
924346684 1:243078820-243078842 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
924602579 1:245504391-245504413 ATGAAGGGAGGGAGGGAAGGAGG - Intronic
924665111 1:246063536-246063558 GGGAAGGAAGGGAAGGAAGGAGG - Intronic
924673624 1:246153398-246153420 CTGGAGATAGGGAAGGAGGGAGG + Intronic
1062958659 10:1557090-1557112 CTGAGGCAATGGAAGGAAAGAGG - Intronic
1062966052 10:1608630-1608652 ATGAAGGGAGGGAGGGAAGGAGG + Intronic
1063049446 10:2430861-2430883 CGGAGGGAAGGGAGGGAGGGAGG + Intergenic
1063517308 10:6709600-6709622 CAGAGGGTGAGGAAGGAAGTGGG + Intergenic
1063697989 10:8356389-8356411 AAGAAGGCAGGGAAGGAAGGAGG - Intergenic
1063709717 10:8465448-8465470 TTGAGGGTAGGGGTGGGAGGAGG + Intergenic
1064000798 10:11662251-11662273 AGGAAGGAAGGGAAGGAAGGAGG + Intergenic
1064002228 10:11673266-11673288 AGGAAGGGAGGGAAGGAAGGAGG - Intergenic
1064112836 10:12553376-12553398 CAGGAGGTAGGGAAGGGAGGAGG - Intronic
1064183838 10:13143043-13143065 CAGGGGGTAGGGAAGGAAGATGG - Intergenic
1064225814 10:13483821-13483843 CTGGGGGTACGGGAGGAAGGGGG + Intronic
1064463270 10:15555465-15555487 CTGCGGACAGGGAAGGAGGGAGG + Intronic
1065251816 10:23823265-23823287 CTGAGAGCAGGCAAGGAAGCAGG - Intronic
1065817530 10:29495601-29495623 CTGAGGGGAGGGAGGGACAGTGG + Intronic
1065933546 10:30500182-30500204 AGGAGGGAAGGGAAGGAAGGAGG + Intergenic
1065955331 10:30688797-30688819 CTGAGGGGAGGGAGGGACAGTGG - Intergenic
1066027053 10:31369359-31369381 CAGAGGCTAGGGTAGGAGGGTGG - Intronic
1066381542 10:34906167-34906189 CCGAGGGAAGGCAGGGAAGGCGG - Intergenic
1066504068 10:36023787-36023809 CTGAAGGAAGAGAAGGAAGAAGG - Intergenic
1066523320 10:36247761-36247783 GGGAGGGGAGGGATGGAAGGAGG - Intergenic
1066533714 10:36367475-36367497 GGAAGGGCAGGGAAGGAAGGAGG + Intergenic
1066729665 10:38426029-38426051 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1067033575 10:42897387-42897409 CTGAGCGTGGGGCAGGAAGAGGG + Intergenic
1067110591 10:43397053-43397075 CTGAAGGGAGGGAAGGGAAGAGG + Intronic
1067771707 10:49131427-49131449 CTGTGCCTAGGGCAGGAAGGGGG + Exonic
1067820082 10:49520764-49520786 CTGAGGACAGGGAGGGCAGGTGG - Intronic
1068058061 10:52035309-52035331 TGGTGTGTAGGGAAGGAAGGGGG + Intronic
1068756371 10:60658825-60658847 GGAAGGGTAGGGAGGGAAGGAGG + Intronic
1068775362 10:60862877-60862899 GAGAGAGGAGGGAAGGAAGGAGG - Intergenic
1068807830 10:61219492-61219514 CTAAGGAGAGGGAGGGAAGGAGG - Intergenic
1069354906 10:67573753-67573775 TTGAGGGAAGGGAAGGATAGAGG - Intronic
1069637760 10:69936062-69936084 GTGAGGGAAGGGAGGGAGGGAGG + Intronic
1069657150 10:70098360-70098382 GGGAAGGTAGAGAAGGAAGGAGG + Intronic
1069802583 10:71091242-71091264 CTGAGGGTGAGGAAGGAGGGTGG + Intergenic
1070148804 10:73792853-73792875 GTGAGGGGATGGAAGGAGGGAGG + Intronic
1070317332 10:75327249-75327271 CTAAGGGTAGGGAAGGGTAGGGG - Intergenic
1070509468 10:77147426-77147448 CAGGGGGAAGGGAAGGAGGGAGG - Intronic
1070852694 10:79580697-79580719 AGGAAGGGAGGGAAGGAAGGAGG + Intergenic
1071017484 10:81015070-81015092 CAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071809110 10:89159091-89159113 AAGAAGGGAGGGAAGGAAGGAGG + Intergenic
1071867738 10:89755446-89755468 GGGAGGGGAGGGAAGGAAAGGGG - Intronic
1072333886 10:94380261-94380283 TTGAGGTTATGGAAGGAATGGGG - Intergenic
1072641387 10:97213693-97213715 GTGAGGGTGGGAAAGTAAGGTGG - Intronic
1072662805 10:97373015-97373037 CGGAAGGGAGGGAAGGAGGGAGG - Intronic
1072693194 10:97584781-97584803 CTCAGGGGAGGGGAAGAAGGTGG + Exonic
1072733508 10:97864098-97864120 CTGAGGGAAGGGATGCACGGTGG - Intronic
1073091110 10:100940720-100940742 GGGAGGGAAGGGAGGGAAGGAGG - Intronic
1073394467 10:103206744-103206766 CAGGCGGTAGGGAAAGAAGGAGG - Intergenic
1073594709 10:104788152-104788174 CTGAGTCTAGGTGAGGAAGGTGG + Intronic
1073625343 10:105091074-105091096 CAGGAGGGAGGGAAGGAAGGAGG - Intronic
1073801939 10:107051019-107051041 AGGAAGGGAGGGAAGGAAGGAGG - Intronic
1074018911 10:109563889-109563911 CAGATGGGAGGGAAAGAAGGAGG - Intergenic
1074161987 10:110843095-110843117 CTGAGGGCAAGAGAGGAAGGAGG + Intergenic
1074264682 10:111889771-111889793 CTAGGGGTGGGGAAGGAAAGAGG - Intergenic
1074496713 10:113985971-113985993 AGGAAGGAAGGGAAGGAAGGAGG + Intergenic
1074735641 10:116429803-116429825 CTGCAGGTAGAGAAGGAAGATGG + Intronic
1074791102 10:116888485-116888507 CTGACAGTTGGGAGGGAAGGCGG + Intronic
1074810402 10:117099225-117099247 CTCAGGGTGGGGAGGTAAGGAGG + Intronic
1075262880 10:120978104-120978126 CTGAGGGTGGGGAAGGGGAGAGG + Intergenic
1075382231 10:122028865-122028887 CGGAGGGAAGGGAAGGGAAGGGG - Intronic
1075635229 10:124026131-124026153 CTGAGGGTAGGGGAGGACTGGGG + Intronic
1075732420 10:124644434-124644456 CTAAAGGGAAGGAAGGAAGGAGG - Intronic
1075805780 10:125187888-125187910 TTAAGGGGAGGGAAGAAAGGAGG - Intergenic
1075902793 10:126056563-126056585 GTGAGGGTTTGCAAGGAAGGTGG + Intronic
1076001494 10:126916685-126916707 AGGAGGGGAGGAAAGGAAGGAGG - Intronic
1076039807 10:127236402-127236424 AGGAAGGAAGGGAAGGAAGGAGG - Intronic
1076290556 10:129342506-129342528 AGGAAGGGAGGGAAGGAAGGAGG + Intergenic
1076508341 10:130993757-130993779 CTGGGGGGAGGCAAGGAACGGGG - Intergenic
1076637829 10:131893919-131893941 CTGAAGGAAGGGAAGAAAGATGG - Intergenic
1076936048 10:133567999-133568021 CTGTGGGCAAGGGAGGAAGGGGG + Intronic
1076946708 10:133656573-133656595 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
1076971675 11:137877-137899 ATGAGAGTTGGGAGGGAAGGGGG - Intergenic
1076973274 11:150668-150690 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1077101208 11:823424-823446 CTGCGGGTAGTGAAGGGAGGTGG + Intronic
1077243613 11:1524977-1524999 CTGGGGAAGGGGAAGGAAGGTGG + Intergenic
1077479048 11:2804460-2804482 ATGAGGGGAGGGAGGGATGGAGG + Intronic
1077670147 11:4149998-4150020 TTGAGGCTGGGGAAGGTAGGGGG + Intergenic
1078390615 11:10932330-10932352 CTGAGGGTCACGATGGAAGGAGG + Intergenic
1078763902 11:14275167-14275189 CTGATGGAAGGGAAAGAAGTTGG + Intergenic
1078923658 11:15854493-15854515 AGGAGGGGAGGGAAGGAAGAGGG + Intergenic
1079111580 11:17608056-17608078 CTGAGGACAGGGAAGGACTGAGG - Intronic
1079163637 11:18016356-18016378 CATAGGGTAGGGATGGGAGGAGG + Intergenic
1079292642 11:19202043-19202065 CTGGGGGAAGGGCAGGAGGGAGG + Intronic
1079822527 11:25148423-25148445 TAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1079862603 11:25692835-25692857 CTGAGGGAAAGGGTGGAAGGGGG - Intergenic
1080115206 11:28614543-28614565 CTGAGGGTTGGGATGAAATGCGG - Intergenic
1080336445 11:31202906-31202928 CTGAGGGGATGGATGGAGGGTGG + Intronic
1080387279 11:31817632-31817654 CTGAGGGAGGGATAGGAAGGGGG - Intronic
1080438554 11:32268956-32268978 GGGAGGGAAGGGAAGGAAAGTGG + Intergenic
1080504019 11:32894053-32894075 CTGAGAGTTGGGAAGAAATGGGG + Intronic
1080833163 11:35915350-35915372 CTGAGTGTAGGAAAAGAAAGGGG + Intergenic
1081154861 11:39677480-39677502 CTGAGCCTAGCGAGGGAAGGAGG + Intergenic
1081188076 11:40069857-40069879 GAGAGGGGAGGGCAGGAAGGGGG + Intergenic
1081648167 11:44804509-44804531 CTGAAGGAAGGAAAGGAGGGAGG + Intronic
1082262424 11:50087179-50087201 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1082853823 11:57788666-57788688 CTTAGGGGTGGGAAGGGAGGGGG + Intronic
1082856663 11:57814210-57814232 GTGAATGAAGGGAAGGAAGGAGG + Intronic
1082958523 11:58897236-58897258 TTCAGGGTGAGGAAGGAAGGAGG - Intronic
1083176406 11:60952552-60952574 GTGGGGCTAGGGCAGGAAGGTGG + Intergenic
1083187140 11:61024276-61024298 GGGAGGGTAGGGAAGGAGGGAGG - Intergenic
1083269643 11:61565346-61565368 TTGAGGGGAGGGAGGGAAGCAGG - Intronic
1083303123 11:61749088-61749110 CAGAGGCTGGGGCAGGAAGGTGG - Intergenic
1083417793 11:62536516-62536538 CTGAGGGGAAGAGAGGAAGGAGG - Exonic
1083418583 11:62541000-62541022 CCGAGGGCAGTGGAGGAAGGAGG - Intronic
1083520483 11:63306247-63306269 CAGAGGCTAGGGAAGGAAGAAGG - Intronic
1083583341 11:63839185-63839207 CTGAGGGCAGGGGAGGAGCGAGG + Exonic
1083595427 11:63916562-63916584 CTGAGGTTAGGAGAGGCAGGAGG + Exonic
1083609546 11:63998517-63998539 CTGACTGGGGGGAAGGAAGGCGG - Intronic
1083766835 11:64845269-64845291 CTGAGGCTTGGGAAGGAGGAAGG + Intergenic
1083790562 11:64982638-64982660 CTGGAGGGAGGGAATGAAGGAGG - Intergenic
1084394302 11:68898746-68898768 CTGAGGGTGGGGAGGGGAAGTGG - Intronic
1084725157 11:70936949-70936971 CTCAGGGAGGGAAAGGAAGGTGG - Intronic
1084967167 11:72750845-72750867 CTGAAGGCTGGGCAGGAAGGAGG + Intronic
1085177665 11:74505030-74505052 CTGAGGGTGGGACAGGAAGCAGG + Intronic
1085284340 11:75350363-75350385 GGGAGGGGAGGAAAGGAAGGAGG + Intronic
1085300127 11:75453012-75453034 CGGTGGGTGGGGCAGGAAGGGGG + Intronic
1085346942 11:75774303-75774325 CTGAGGGTAAGGAAGGGTAGTGG - Intronic
1085479098 11:76806962-76806984 GAGAGGGAAGGGAGGGAAGGAGG + Intergenic
1085908095 11:80788809-80788831 GTGAGGATATGGAAAGAAGGTGG - Intergenic
1086209187 11:84297721-84297743 CTGGGGGCATGGAAGGAAGTCGG - Intronic
1086597868 11:88595402-88595424 TAGAGGGTAGGAAGGGAAGGAGG - Intronic
1086920929 11:92585902-92585924 AGGAAGGGAGGGAAGGAAGGAGG - Intronic
1087158360 11:94925990-94926012 CTAAGTGTGGGGAAGGTAGGAGG + Intergenic
1087263997 11:96041515-96041537 GGGAAGGAAGGGAAGGAAGGAGG + Intronic
1087527169 11:99330215-99330237 GAGAAGGAAGGGAAGGAAGGAGG + Intronic
1087906100 11:103699707-103699729 AGGAGGGAAGGGAGGGAAGGAGG - Intergenic
1088135312 11:106550056-106550078 CTGAGGGTAGGCAAAGAAGAGGG - Intergenic
1088246174 11:107820299-107820321 GGGAGGGGAAGGAAGGAAGGAGG + Intronic
1088321604 11:108560015-108560037 GTGTGGGTAGGGTGGGAAGGAGG - Intronic
1088457078 11:110043974-110043996 GGAAGGGAAGGGAAGGAAGGAGG + Intergenic
1088524309 11:110736325-110736347 AAGAAGGAAGGGAAGGAAGGAGG + Intergenic
1088693875 11:112349819-112349841 CTGGGGACAGGAAAGGAAGGGGG + Intergenic
1088740504 11:112763215-112763237 CTGAGGTTTGGAAAGGAAGCAGG - Intergenic
1088809260 11:113379294-113379316 CTGGGGGTGGAGAAGGGAGGGGG - Intronic
1088928759 11:114328071-114328093 CTGAGGGTGGGGAAGGAGGTTGG - Intergenic
1088989043 11:114935560-114935582 CTGGAGGTAGGTATGGAAGGAGG + Intergenic
1089029382 11:115308767-115308789 ATGAAGGGAGGGAGGGAAGGAGG - Intronic
1089303483 11:117512602-117512624 CTGAGGGTGGGGAAGGGGGAAGG + Intronic
1089519592 11:119055061-119055083 CTGAGGGGAAGGAAGGTAGTTGG + Intronic
1089560723 11:119341829-119341851 CTGGGTGGAGGGAAGGAGGGCGG - Intronic
1089572760 11:119421102-119421124 CTCAGGGAAAGCAAGGAAGGAGG + Intronic
1089682977 11:120129749-120129771 CGGAGGGTGGGGAAGGCATGGGG + Intronic
1089850864 11:121495327-121495349 CTGAGGCCAGGGTAGGGAGGGGG - Intronic
1090062620 11:123477252-123477274 GAGGGGGAAGGGAAGGAAGGGGG - Intergenic
1090244010 11:125202865-125202887 CTGGGGGTAGAGAGGAAAGGTGG - Intronic
1090313429 11:125763885-125763907 CTGAGGGTGTGGAAGGCAGGAGG - Intergenic
1090650083 11:128798851-128798873 CTGACAGTGGGGGAGGAAGGAGG + Intronic
1091010873 11:131999156-131999178 CTGAGGGTGCAGAAGCAAGGAGG + Intronic
1091235620 11:134020380-134020402 TTGAGGGAAGGGCAGGAAGGAGG - Intergenic
1091373758 12:13268-13290 CTGAGGCTGAGGAAGGAAAGGGG + Intergenic
1091453554 12:588230-588252 CAGAAGGGAGGGAAGGGAGGAGG + Intronic
1091481312 12:834547-834569 CTGAGGTAAGGGAAGCAAGATGG + Intronic
1091604219 12:1936453-1936475 CTAAGGGCACGGCAGGAAGGAGG - Intergenic
1091692366 12:2605811-2605833 CTGATGGGAGGGGAGGTAGGAGG - Intronic
1091807514 12:3366600-3366622 ATGAGGGGAGGGGAGGAAGGGGG - Intergenic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1092037766 12:5353799-5353821 CAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1092048796 12:5453358-5453380 CTTAGGGAAGGGGAGGCAGGAGG - Intronic
1092354699 12:7784846-7784868 CTGAGGGTAGGGTGGGAAGGAGG + Intergenic
1092367037 12:7884878-7884900 CTGAGGGTAGGGTGGGAAAGAGG + Intronic
1092493443 12:8967969-8967991 TTAAGGAAAGGGAAGGAAGGAGG + Intronic
1093288378 12:17294672-17294694 ATGAGGGTAGGGAAGGAGGTAGG - Intergenic
1093838612 12:23868084-23868106 AAGAAGGGAGGGAAGGAAGGAGG - Intronic
1094532369 12:31288654-31288676 CTCAGGGCAGGGAAAGAGGGAGG - Intronic
1094641908 12:32283990-32284012 GGGAGGGCAGGGAAGGAAAGGGG - Intronic
1094749804 12:33392756-33392778 CTGAGGTCAGGGCAGGAACGGGG + Intronic
1094778821 12:33765593-33765615 GAGAGTGAAGGGAAGGAAGGTGG - Intergenic
1095271771 12:40226883-40226905 CAGAGTCTAGGGAATGAAGGTGG - Intronic
1095416236 12:41979744-41979766 CTGAGGGCAAGGGAGGAATGAGG + Intergenic
1095646252 12:44551589-44551611 CTGAGGGTAGGCACTGAAGAAGG - Intronic
1095791234 12:46169575-46169597 CTGAGGGGAGGGAGGGAAATGGG + Intergenic
1095937890 12:47705183-47705205 CGGAGGGAAGAGAAGTAAGGTGG + Intronic
1095989880 12:48027381-48027403 CTGGGGCGAGGGAAGGCAGGAGG - Intergenic
1096036239 12:48473565-48473587 GTGAGGGAAGGGAGGGGAGGAGG + Exonic
1096098985 12:48957432-48957454 CTAGGTGGAGGGAAGGAAGGAGG - Exonic
1097232923 12:57523048-57523070 CAGAGGGTAGGGACGGGAGGGGG - Intronic
1097661636 12:62436481-62436503 CTGAGGATAGGGAAGCCAAGTGG - Intergenic
1097805579 12:63961373-63961395 CTGGGGGTGAGGAAAGAAGGGGG - Intronic
1097991097 12:65834635-65834657 TTGAAGGAAGGGAAGGAGGGAGG - Intronic
1098448338 12:70590741-70590763 CAAAGGGTAGGGAAGGAGAGAGG - Intronic
1098651610 12:72977536-72977558 TTGAGGGTACGGAAAGAATGAGG + Intergenic
1098661453 12:73100043-73100065 AGGAAGGAAGGGAAGGAAGGAGG - Intergenic
1099134893 12:78885262-78885284 AGGAGGGAAGGGAAGGAAGGAGG + Intronic
1100184497 12:92124788-92124810 ATGAGTTTAGGGAAGGAAGCCGG - Intronic
1100761465 12:97811826-97811848 TGGAGGGAAGGGAAGGAGGGAGG + Intergenic
1101085820 12:101234808-101234830 GTGAAGGTAGGGAAAGGAGGGGG - Intergenic
1101348287 12:103905626-103905648 AGGAGGGGAGGGAGGGAAGGAGG + Intergenic
1101531741 12:105579953-105579975 CTCCAGGTAGGGAAGGATGGAGG + Intergenic
1101752792 12:107596745-107596767 AGGAGAGTAGGGAGGGAAGGAGG - Intronic
1101879580 12:108617127-108617149 CTGCCAGCAGGGAAGGAAGGAGG - Intergenic
1102123167 12:110458971-110458993 CTGAGGGTGAGGAAGGCAGAGGG - Intronic
1102538996 12:113604970-113604992 CATAAGGTAGGGAAGGATGGTGG - Intergenic
1102547963 12:113670262-113670284 CTCAGGCTGGGGAAGGACGGAGG + Intergenic
1102553717 12:113711822-113711844 CTGAAGGAAGGAAAGGGAGGAGG - Intergenic
1102561044 12:113762530-113762552 CTGGGGGTGGGGAGGGAGGGGGG - Intergenic
1102723258 12:115035820-115035842 CTGGAGGGAGGGAAGGAAGGGGG - Intergenic
1102736104 12:115161105-115161127 CAGTAGGAAGGGAAGGAAGGCGG + Intergenic
1102959858 12:117085407-117085429 GTGAGGGTCGGGAAGGCAGAAGG + Intronic
1103058291 12:117838576-117838598 CTCAGGGGAAGGCAGGAAGGAGG - Intronic
1103080426 12:118019609-118019631 CTGAGGATCAGGAAGGAAGAAGG - Intronic
1103151958 12:118648483-118648505 CTGGGGGAAGGGAAGGAAGCAGG + Intergenic
1103238968 12:119397901-119397923 GGCAGGGTGGGGAAGGAAGGGGG + Intronic
1103246737 12:119464379-119464401 GAAAGGGGAGGGAAGGAAGGAGG - Intronic
1103255819 12:119540540-119540562 TTGAGGGGAGGGAGAGAAGGTGG + Intronic
1103341426 12:120223123-120223145 CAGAGGGTAGGGAAGGGATGTGG + Intronic
1103495285 12:121357352-121357374 AGGAAGGGAGGGAAGGAAGGAGG + Intronic
1103616377 12:122155525-122155547 CTGAGGGCAGGAGAGGAGGGAGG - Intergenic
1103693310 12:122793480-122793502 CTGGGGGTAGGTAAGGAATATGG + Intronic
1103805920 12:123572774-123572796 CTTAGGATAGGGGAGGAATGAGG - Intergenic
1103889385 12:124227378-124227400 CTGGGGGAAGGGAAGGAATGAGG + Intronic
1104159978 12:126168664-126168686 CTGAGAGAAGGGAAGGAATGAGG + Intergenic
1104738651 12:131156242-131156264 ATAAAGGGAGGGAAGGAAGGAGG - Intergenic
1104903722 12:132202723-132202745 CAGTGGCCAGGGAAGGAAGGGGG + Intronic
1104916422 12:132267189-132267211 ATGAGGGCAGGGAAGGAGGCAGG + Intronic
1104956774 12:132470575-132470597 AGGAGGGGAGGGAAGGGAGGAGG + Intergenic
1104987743 12:132606466-132606488 CTGAGGCAGGGGAAAGAAGGTGG - Intronic
1105281530 13:18965367-18965389 CTGGGGGTGGGACAGGAAGGTGG + Intergenic
1105891723 13:24686919-24686941 GTGAGAGCAGGGAAGGCAGGAGG + Intronic
1105940970 13:25147692-25147714 CTGGGGGTAGGGAGGGAATCAGG + Intergenic
1106028488 13:25977039-25977061 CCGAGGGCAGGGAAGGGGGGTGG - Intronic
1106090756 13:26591180-26591202 GTTAGGGGAGGGAAGGAAGCAGG + Intronic
1107237697 13:38192753-38192775 ATGAGGTCAGGGAAGGAGGGCGG - Intergenic
1107333086 13:39322692-39322714 CAGAAGGGAGAGAAGGAAGGAGG + Intergenic
1107507595 13:41050165-41050187 CTGGGGGTAAGGGAGAAAGGGGG - Intronic
1107834919 13:44405299-44405321 GGGAGAGTGGGGAAGGAAGGTGG - Intergenic
1108068979 13:46607949-46607971 CTGAGGGCAGGGAGGGATGTGGG + Intronic
1108326857 13:49341572-49341594 CAGAGGCTGGGGAAGGTAGGAGG + Intronic
1108851395 13:54736095-54736117 GTGAGGGAAGGGAAGGGAGAGGG - Intergenic
1109520321 13:63501909-63501931 CTGAGTGTAAGGTGGGAAGGTGG + Intergenic
1111066255 13:83096261-83096283 AAGAAGGGAGGGAAGGAAGGAGG + Intergenic
1111286965 13:86106773-86106795 CAGAGGCTAGGGGATGAAGGTGG - Intergenic
1111617287 13:90676098-90676120 AAGAGGGTAGGGGAGGAAGCAGG + Intergenic
1112088081 13:96052993-96053015 CCCCGGGTCGGGAAGGAAGGAGG + Intronic
1112181972 13:97091921-97091943 CAGAGGCTGGGGAGGGAAGGAGG + Intergenic
1112441419 13:99427097-99427119 CGGAGGGTAGGGTGGGAGGGAGG + Intergenic
1112446824 13:99471843-99471865 AGGAAGGGAGGGAAGGAAGGAGG + Intergenic
1112629201 13:101141739-101141761 CTGTGGGAAGGGAAAGAAAGCGG + Intronic
1113311175 13:109134760-109134782 CTGAGGTGATGGAAGGAACGTGG - Intronic
1113600202 13:111563225-111563247 GGGAGGGGAGGGAAGGAAAGAGG - Intergenic
1113600212 13:111563250-111563272 GTGAGGGGAGGGAAGGAAAGAGG - Intergenic
1113600226 13:111563300-111563322 GGGAGGGGAGGGAAGGAAAGAGG - Intergenic
1113600236 13:111563325-111563347 GTGAGGGGAGGGAAGGAAAGAGG - Intergenic
1113600250 13:111563375-111563397 GTGAGGGGAGGGAGGGAAAGAGG - Intergenic
1113923287 13:113926595-113926617 CAGAGGATGGGGAAGGAATGAGG + Intergenic
1114516985 14:23306806-23306828 AGGAAGGGAGGGAAGGAAGGAGG - Exonic
1114523509 14:23352997-23353019 CCCAGGGGAGGGAGGGAAGGGGG + Intergenic
1114564403 14:23619017-23619039 CTGAGGGGAAGAAAAGAAGGTGG - Intergenic
1114639977 14:24213180-24213202 CTGAGAGTGGGGGAGGACGGCGG + Intronic
1114836004 14:26203686-26203708 CTGAGGGTACAGAAGAAAAGGGG - Intergenic
1114957168 14:27837349-27837371 CTTAGGGTAGGGAAAGAGAGTGG - Intergenic
1115111618 14:29830280-29830302 TAGAGGGTGGGGAAGGAGGGAGG - Intronic
1115258994 14:31433797-31433819 CTGAAGGTAGGGAGGAAATGGGG + Intronic
1115510026 14:34129788-34129810 CTATGGGTGGGGAAGGGAGGTGG + Intronic
1115749323 14:36472848-36472870 TTGGAGGGAGGGAAGGAAGGGGG + Intergenic
1115794469 14:36918130-36918152 CTGAGGGTAGGAACTTAAGGAGG - Intronic
1116475094 14:45331009-45331031 GGGAGGAAAGGGAAGGAAGGAGG - Intergenic
1116475224 14:45331496-45331518 GGGAGGGGAGGGAAGGAGGGAGG - Intergenic
1116559341 14:46358744-46358766 CAGAGGCTGGGGAAGGGAGGAGG + Intergenic
1116813251 14:49559980-49560002 AAGAGGGAAGGGAAGGAGGGGGG - Intergenic
1117694737 14:58349012-58349034 CTAAGGGTTGGGGAGGAATGAGG - Intronic
1117699259 14:58396518-58396540 CAAAAGGGAGGGAAGGAAGGAGG + Intronic
1117812449 14:59562573-59562595 CTGATGGAGGGGTAGGAAGGTGG + Intronic
1118467777 14:66046373-66046395 GTGAAGAAAGGGAAGGAAGGAGG - Intergenic
1118723835 14:68612824-68612846 AGGAAGGGAGGGAAGGAAGGAGG + Intronic
1118765046 14:68904037-68904059 TGTTGGGTAGGGAAGGAAGGAGG - Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119673843 14:76539191-76539213 CAAAGGGAAGGGAAGGGAGGGGG - Intergenic
1119680005 14:76585103-76585125 CTGGGAGAAGGGAAAGAAGGAGG + Intergenic
1119686113 14:76632672-76632694 CTGAGGAGAGGGAAGGTTGGAGG + Intergenic
1119717422 14:76868742-76868764 CTGAGTGGAGCGAAGGAAAGAGG - Intronic
1120325892 14:83025745-83025767 GGGAGGGGAGGGAAGGAGGGAGG + Intergenic
1120685596 14:87532804-87532826 CTCAGGGTAGGGAAAGAACAAGG + Intergenic
1120723296 14:87910742-87910764 CTGAGGGTAGAGGAGGGAGGAGG - Intronic
1121342133 14:93111769-93111791 CCCAGGCTAGGGAAGGCAGGTGG + Intronic
1121556157 14:94839364-94839386 CTGATGGGAGGGAAGGAGGAAGG - Intergenic
1121797087 14:96744184-96744206 CTGTGGGAAGAGAAGTAAGGAGG + Intergenic
1121825237 14:97004971-97004993 CGGAAGGAAGGAAAGGAAGGAGG - Intergenic
1121843866 14:97156274-97156296 CTGAGAGGAAGAAAGGAAGGAGG - Intergenic
1122096511 14:99376608-99376630 GGGAGGGAAGGGAGGGAAGGAGG + Intergenic
1122126329 14:99580465-99580487 GTGAGGGGAGGGGGGGAAGGGGG + Intronic
1122375963 14:101257578-101257600 CTGAGGGTCAGCAAGGAATGAGG + Intergenic
1122572751 14:102718575-102718597 CTGAGGGTTGGGTGGGAGGGTGG + Intronic
1122769807 14:104092945-104092967 AGGAGGGTGGGGAGGGAAGGTGG - Intronic
1122903174 14:104790343-104790365 CTGGGGGTGGGGAGGGAGGGAGG - Intronic
1122916435 14:104861171-104861193 CAGAGGGTAGTGATGGATGGTGG - Intergenic
1122916442 14:104861210-104861232 CAGAGGGTAGTGACGGACGGTGG - Intergenic
1122916449 14:104861249-104861271 CGGAGGGTAGTGATGGATGGTGG - Intergenic
1123038360 14:105480410-105480432 CTGTGGGGAGGTAAGGAAGGTGG + Intergenic
1123040956 14:105490108-105490130 CTGCGGGCGGGGAAGGACGGAGG + Intronic
1123115444 14:105892272-105892294 CTTCGGGGAGGGAAGGATGGAGG - Intergenic
1123119694 14:105910990-105911012 CTTTGGGGAGGGAAGGATGGAGG - Intergenic
1123168474 14:106349011-106349033 CTTGTGGTAGGAAAGGAAGGAGG - Intergenic
1202920792 14_KI270723v1_random:29127-29149 CAGAGAGTAGGGAAGGAAGTCGG + Intergenic
1202924124 14_KI270724v1_random:8454-8476 CAGAGAGTAGGGAAGGAAGTCGG - Intergenic
1123503625 15:20915489-20915511 CTGAGTGTGGCGAGGGAAGGTGG - Intergenic
1123560872 15:21489163-21489185 CTGAGTGTGGCGAGGGAAGGTGG - Intergenic
1123597111 15:21926454-21926476 CTGAGTGTGGCGAGGGAAGGTGG - Intergenic
1124575402 15:30903693-30903715 CTGCGGGTGGGAAAGGAAGGAGG + Intergenic
1124598422 15:31110906-31110928 CAGAAGGGAGGGAGGGAAGGGGG - Intronic
1125368855 15:38948294-38948316 TTGCGGGGAGGGGAGGAAGGAGG + Intergenic
1126010780 15:44300173-44300195 AGGAAGGGAGGGAAGGAAGGAGG + Intronic
1126642500 15:50841992-50842014 AAGAGGGAAGGGAAGGGAGGGGG - Intergenic
1127164425 15:56229975-56229997 GTGAGGGCAGATAAGGAAGGAGG - Intronic
1127232693 15:57014352-57014374 CTGATGGTAGGGAATGAGGAAGG - Intronic
1127369826 15:58329403-58329425 CTGAGGGTAGGAAGAGTAGGAGG + Intronic
1127402135 15:58599191-58599213 AAGATGGAAGGGAAGGAAGGAGG + Intronic
1127499209 15:59541240-59541262 GGGAGGGAAGGGAAGGAGGGAGG - Intergenic
1127507465 15:59610598-59610620 ATGGAGGGAGGGAAGGAAGGAGG - Intronic
1127761705 15:62146180-62146202 GTGAGGGTAGGGAAGGAGGGTGG - Intergenic
1128312112 15:66637299-66637321 TTGAGGGAAGGGCAGGGAGGAGG + Intronic
1128556834 15:68637572-68637594 CTGAGCCTGGAGAAGGAAGGCGG + Intronic
1128619103 15:69133754-69133776 CTGAGGACAGGGAAGGAGTGTGG + Intergenic
1128999126 15:72318748-72318770 GTGAGGGGAGGGAAAGAAAGAGG + Intronic
1129150698 15:73685856-73685878 CTGAGTGCAGGGCAGGATGGAGG + Intronic
1129208404 15:74051061-74051083 CTGGGGCTAGGGGAGGAATGGGG + Intergenic
1129228522 15:74183689-74183711 TTAAGGGCAGGGAAGGCAGGGGG + Intronic
1129384028 15:75185813-75185835 GAGAAGGTAGGGAAGGAAGTGGG + Intergenic
1129442114 15:75588937-75588959 GGGAGGGGAGGGAAGGAAAGGGG + Intergenic
1129521551 15:76189579-76189601 CTGAGAGTCTGGGAGGAAGGGGG + Intronic
1129680753 15:77657238-77657260 CTGAGGTCAGGGGAGGGAGGAGG - Intronic
1129850349 15:78790160-78790182 CGGAGGTTAGGGGAGGAAGGTGG + Intronic
1130071885 15:80654441-80654463 CTGAGTGTTGTGAGGGAAGGAGG - Intergenic
1130133699 15:81164202-81164224 CTTGGGTTAGGGAAGGATGGTGG - Intronic
1130251920 15:82305390-82305412 CGGAGGTTAGGGGAGGAGGGAGG - Intergenic
1130427032 15:83811691-83811713 CTTGGGGTAGAGTAGGAAGGAGG + Intronic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1131032722 15:89199943-89199965 CAGAGGGGAAGGAAGGAAGCAGG - Exonic
1131264969 15:90910407-90910429 AGGAGGGGTGGGAAGGAAGGAGG + Intronic
1131306868 15:91252731-91252753 ATGAAGGAAGGGAAGGAAGGAGG - Intronic
1131343935 15:91628716-91628738 CTAAAGGTAGAGAAGGAAAGGGG - Intergenic
1131382382 15:91974595-91974617 CTGTGGGCAGGGCAGGGAGGCGG + Intronic
1131434499 15:92412265-92412287 ATGAGAGGAGGGAAGGAAGGGGG + Intronic
1132209787 15:100011385-100011407 CAGAAGGGAGGGAAGGAAGGAGG + Intronic
1132246695 15:100302073-100302095 CTGAGGGTGGGGAAGGACAGAGG - Intronic
1202969217 15_KI270727v1_random:216327-216349 CTGAGTGTGGCGAGGGAAGGTGG - Intergenic
1132643842 16:989851-989873 CTGGGGGAAGGGAAGGGAAGGGG + Intergenic
1132701293 16:1223196-1223218 CCGAGGGGAGGGAAGGAGGGAGG + Intronic
1132836087 16:1954149-1954171 CTGGGGGGCAGGAAGGAAGGAGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133231177 16:4367267-4367289 CGGAGGGTAGGGGACCAAGGTGG + Intronic
1133320302 16:4909379-4909401 CTGAGGGTGGGGAGGTCAGGAGG - Intronic
1133324799 16:4936295-4936317 CAGAGGGTGGGGAGGTAAGGGGG + Intronic
1133484326 16:6204167-6204189 GTGAGGGTAGGGGAGGAAAAGGG - Intronic
1133808613 16:9144339-9144361 TTGAGGGTGAGGATGGAAGGCGG + Intergenic
1133850616 16:9500054-9500076 CCTAGGGGAGGGAAAGAAGGAGG - Intergenic
1133985367 16:10664264-10664286 CTGCAGGGAGGGAAGGAAGAGGG + Intronic
1134024630 16:10944573-10944595 CTGTGGGCCGGGGAGGAAGGCGG + Exonic
1134440484 16:14296911-14296933 GGGAAGGAAGGGAAGGAAGGAGG - Intergenic
1134811623 16:17172184-17172206 GAGAGAGGAGGGAAGGAAGGAGG - Intronic
1135016516 16:18928284-18928306 CGGAGGGTAGGGAGGGAGGGAGG + Intergenic
1135927654 16:26709744-26709766 AAGAGGGAAGGGAGGGAAGGAGG + Intergenic
1136089901 16:27911231-27911253 ATGAGGCTAGAGAAGAAAGGAGG - Intronic
1136232401 16:28894394-28894416 CAGAGGGTAAGGAAGGACAGTGG - Intronic
1136333633 16:29597264-29597286 CGGAGGGTAGGGAGGGAGGGAGG + Intergenic
1136372472 16:29844967-29844989 TTGAGGGTAGGGATGGCAGCAGG - Intronic
1136568560 16:31083810-31083832 CTGTGGGGAAGGAAGGAGGGTGG + Exonic
1136597605 16:31262310-31262332 GGGAGGGAAGGGAGGGAAGGAGG - Intronic
1136720401 16:32315272-32315294 GTGAGGTTAGGAAAGGAAGTAGG + Intergenic
1136838778 16:33521546-33521568 GTGAGGTTAGGAAAGGAAGTAGG + Intergenic
1138044338 16:53705136-53705158 TTGAGGGAAGGGAGAGAAGGTGG - Intronic
1138200072 16:55081916-55081938 CAGAGGGAAGGGAAGGGAAGGGG - Intergenic
1138272015 16:55702198-55702220 CTGAGGTCCGTGAAGGAAGGGGG + Intronic
1138506263 16:57479819-57479841 GGGAGGGAAGGGAAGGAAGAAGG - Intronic
1138654267 16:58481797-58481819 CTGAGGGTGGGGCAGGGATGGGG - Intronic
1139131196 16:64148266-64148288 AGGAAGGAAGGGAAGGAAGGAGG - Intergenic
1139131206 16:64148321-64148343 AAGAAGGAAGGGAAGGAAGGAGG - Intergenic
1139190919 16:64861941-64861963 AAGAGGCAAGGGAAGGAAGGAGG + Intergenic
1139388818 16:66592307-66592329 GGAAGGGAAGGGAAGGAAGGAGG + Intergenic
1139654084 16:68376954-68376976 GAGCGGGTAGGGAAGGAAGCAGG - Intronic
1139782604 16:69364298-69364320 CTCAGGGAAGGGAGGGAGGGAGG - Intronic
1140221446 16:73047528-73047550 CAGAGGGAAGGGAAGGAAGGAGG + Intronic
1140711799 16:77685750-77685772 AGGAGGGTAGGGAAGGAGTGGGG - Intergenic
1140866444 16:79066514-79066536 AGGAAGGGAGGGAAGGAAGGAGG + Intronic
1140914621 16:79482969-79482991 GGGAGGGGAGGGAGGGAAGGAGG - Intergenic
1140914716 16:79483205-79483227 GGGAGGGGAGGGAGGGAAGGAGG - Intergenic
1141113033 16:81285913-81285935 CTGAGGGTAAGGAAGTCAGCAGG + Intronic
1141236364 16:82221462-82221484 CAGAGGCTGGGGAGGGAAGGAGG - Intergenic
1141403570 16:83772046-83772068 CTGTGGGTGGAGAAGGATGGGGG + Intronic
1141557582 16:84846210-84846232 GGGAGGGAAGGGAAGGAGGGAGG - Intronic
1141604383 16:85144574-85144596 CTGGGGGTAGGGAAGGGAGGAGG + Intergenic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1142218480 16:88841465-88841487 TTGAGGAAAGGGAAGGACGGGGG - Intronic
1142325438 16:89411886-89411908 CTGAGGGGAGGGATGGAACATGG - Intronic
1142346872 16:89559769-89559791 GTGAGGGTAGGGAAGAAAGAGGG + Intergenic
1142368010 16:89660438-89660460 CAGAGGGTGGGGGAGGAAGGTGG + Intronic
1142446977 16:90146858-90146880 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1142448573 16:90159645-90159667 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1203006031 16_KI270728v1_random:202497-202519 GTGAGGTTAGGAAAGGAAGTAGG - Intergenic
1203148943 16_KI270728v1_random:1821834-1821856 GTGAGGTTAGGAAAGGAAGTAGG + Intergenic
1142458912 17:75644-75666 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1142460515 17:88473-88495 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1142743790 17:1945008-1945030 CTGCGGCTGGGGAGGGAAGGAGG - Intronic
1142856159 17:2731491-2731513 CGGGGGTTGGGGAAGGAAGGCGG + Intergenic
1142880423 17:2879060-2879082 CAGTGGGTAGGGCAGGAAGGAGG - Intronic
1142890450 17:2939681-2939703 CTCAGGGCAGGGATGGAGGGGGG + Intronic
1142992195 17:3739011-3739033 ATGAGGGAAGGGGAGGAAGGGGG - Intronic
1143365443 17:6405494-6405516 CATAGGGTAGGGAGGGCAGGTGG + Intronic
1143389634 17:6552634-6552656 CTATGGGTAGGGGTGGAAGGTGG - Intronic
1143583406 17:7839208-7839230 ATGAGGGTTGGGAAGGGAGTGGG + Intergenic
1143586127 17:7851422-7851444 CAGAGGGAGGGGAAGGAAGCAGG - Intronic
1143614595 17:8042345-8042367 TGGAGGGTAGAGAGGGAAGGTGG - Intronic
1143756733 17:9072932-9072954 AGGAGGGTGGGGAAGGAAAGAGG - Intronic
1143901207 17:10176114-10176136 CTGAAGGCAGGGAAGGATGAAGG + Intronic
1144166842 17:12620461-12620483 CTGAGAGGAGAGAAGGCAGGGGG - Intergenic
1144348353 17:14369907-14369929 CTGAGGCTAGGGATAGAGGGAGG + Intergenic
1144365697 17:14542082-14542104 GGGAGGGAAGGGAAGGGAGGGGG - Intergenic
1144447506 17:15344566-15344588 GGGAGGGGAGGGAAGGAAGCAGG + Intergenic
1144486397 17:15668565-15668587 CAGAGGCTAAGGAAGGAACGAGG - Intronic
1144579543 17:16450666-16450688 CTGTGTGGAGGGAAGCAAGGCGG + Intronic
1144914623 17:18713727-18713749 CAGAGGCTAAGGAAGGAACGAGG + Intronic
1145266900 17:21383998-21384020 CTGGGGGTGGGGGAGGCAGGGGG - Intronic
1145274152 17:21420123-21420145 CAGAAGGAAGGGAAGGCAGGAGG - Intergenic
1145312014 17:21706022-21706044 CAGAAGGAAGGGAAGGCAGGAGG - Intergenic
1145759754 17:27419417-27419439 CTGAGGGCAGTGGTGGAAGGGGG + Intergenic
1145859390 17:28195146-28195168 CTGGGGGGAGGGTAGGGAGGAGG + Exonic
1145978313 17:28996939-28996961 CTTAGGGTAGGGAAGGACCAAGG + Intronic
1146086417 17:29833944-29833966 GGGAGGGTAGGAAGGGAAGGAGG - Intronic
1146342557 17:32033348-32033370 GGGAGGGAAGGGAAAGAAGGAGG + Intronic
1146485772 17:33241402-33241424 GTGAGAGCAGAGAAGGAAGGGGG - Intronic
1146659043 17:34652442-34652464 GTGATGGTGGGGAAGGGAGGAGG - Intergenic
1146688466 17:34857065-34857087 ATGGAGGTAGGGAAGGATGGAGG + Intergenic
1147170232 17:38614214-38614236 ATGTGTGTAAGGAAGGAAGGGGG - Intergenic
1147192568 17:38746693-38746715 TTGGGGGTTGGGCAGGAAGGGGG - Intronic
1147565415 17:41533293-41533315 AGGAGGGGAGGGAAAGAAGGAGG + Intergenic
1147638152 17:41976531-41976553 CCGAGGGCAGGGGAGGGAGGCGG - Exonic
1147796791 17:43049534-43049556 AGGAAGGGAGGGAAGGAAGGTGG - Intronic
1147816414 17:43213898-43213920 GTGAAGCTAGGGGAGGAAGGGGG - Intronic
1147979094 17:44263689-44263711 AGGAGGGAAGGGAGGGAAGGAGG - Intronic
1147994433 17:44353378-44353400 GTGAGGGCTGGGAAGGGAGGGGG - Exonic
1148382504 17:47210062-47210084 GTGAGGGCAGGGTGGGAAGGAGG + Intronic
1148466116 17:47866267-47866289 GGGAGGGCAGGGAAGAAAGGTGG + Intergenic
1148638241 17:49165552-49165574 GTGAGGGGAGAGAAGGAGGGTGG - Intronic
1148869722 17:50649678-50649700 GGGAGGGAAGGGAAGGAGGGAGG + Intronic
1149330412 17:55575713-55575735 GTGTGGGTAGGGAAGAAATGAGG - Intergenic
1149338500 17:55662627-55662649 ATGGGTGAAGGGAAGGAAGGAGG - Intergenic
1149349693 17:55774221-55774243 CTAAGGGTAGGCAAGAAAGCTGG + Intronic
1149422864 17:56527926-56527948 CTGGGGGGAGGGAGGGATGGAGG + Intergenic
1149659351 17:58326279-58326301 CTGAGGGTGGTGAGGAAAGGAGG - Exonic
1150293168 17:63993279-63993301 GGGAGGGAAGGGAAGGAGGGAGG + Intergenic
1150293186 17:63993332-63993354 GGGAGGGAAGGGAAGGAGGGAGG + Intergenic
1150293206 17:63993378-63993400 GGGAGGGAAGGGAAGGAGGGAGG + Intergenic
1150293241 17:63993465-63993487 GGGAGGGAAGGGAAGGAGGGAGG + Intergenic
1150906812 17:69347007-69347029 CTGAGGGGAGGGGAGGGAAGAGG + Intergenic
1150947589 17:69765343-69765365 GGGAGGGAAGGGAAGGAAGAGGG - Intergenic
1151473597 17:74332668-74332690 GTGAGGGTGGGAAAGGAAAGAGG + Intronic
1151952320 17:77362004-77362026 CTGAGGGTAGGAAACAAATGGGG - Intronic
1151978824 17:77497480-77497502 CCGAGGGCAGGGCAGGCAGGTGG - Intronic
1152010126 17:77707777-77707799 CTGATGGGAGGGGAGGAAGAGGG + Intergenic
1152101639 17:78305001-78305023 CTCAGGCCAGGGGAGGAAGGAGG - Intergenic
1152195490 17:78915923-78915945 ATGAGGATAGGGAAGGAAATGGG + Intronic
1152571651 17:81123724-81123746 CTGAGGGAGGGGGAGGGAGGGGG + Intronic
1152795286 17:82303443-82303465 CTGTGGGTAAGGAAGGAAAGGGG + Intergenic
1153015910 18:582547-582569 CTGAGGGCAGGGGAAGGAGGGGG + Intergenic
1153330377 18:3867466-3867488 CACGGGGTGGGGAAGGAAGGAGG + Intronic
1153683315 18:7521745-7521767 CTGGGGGTAGGGGAGGAACCGGG - Intergenic
1154137405 18:11792180-11792202 AGGAAGGGAGGGAAGGAAGGAGG - Intronic
1154332329 18:13440256-13440278 AGGAGGGAAGGGTAGGAAGGAGG - Intronic
1154982014 18:21510357-21510379 CTGAGGGGAGGGAGGGAATGGGG - Intronic
1155032783 18:21998760-21998782 CTGGGTGTAGGGATGGCAGGGGG + Intergenic
1155208392 18:23580286-23580308 CTGGGGGTAGGGGAGGCAGGAGG - Intronic
1155312768 18:24540697-24540719 ATCAAGGTAAGGAAGGAAGGTGG - Intergenic
1155415012 18:25588711-25588733 CTGATGGTGGAGAAGAAAGGAGG + Intergenic
1155710736 18:28875523-28875545 CTGAGTGTGGGTCAGGAAGGGGG - Intergenic
1155882668 18:31169468-31169490 CTAATGGAAGGGAAGGAGGGTGG + Intergenic
1156009825 18:32483789-32483811 GTGAGAGGAGGGAGGGAAGGGGG + Intergenic
1156384504 18:36593420-36593442 CAGAGGAGAGGGAAGCAAGGGGG + Intronic
1156810646 18:41245932-41245954 CAGAGGCTGGGAAAGGAAGGAGG - Intergenic
1156843792 18:41639305-41639327 GGGAGGGAGGGGAAGGAAGGAGG + Intergenic
1156843812 18:41639497-41639519 GGGAGGGGAAGGAAGGAAGGAGG + Intergenic
1157239674 18:45997632-45997654 GGGAGGGGAGGGAGGGAAGGGGG - Intronic
1157310169 18:46546803-46546825 CACAGGGGAGGGAAGGAAGATGG + Intronic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157528193 18:48401060-48401082 TTCAAGGTAGGGAAGGAGGGAGG + Intronic
1157576678 18:48748355-48748377 ATGAAGGGAGGGAGGGAAGGAGG + Intronic
1157612715 18:48968433-48968455 GAGAGGGAAGGGAAGGAGGGAGG + Intergenic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1157792704 18:50546692-50546714 GTGAGGGGAGGGTTGGAAGGTGG + Intergenic
1157944515 18:51964142-51964164 GAGAAGGTAGGGAAGGAATGGGG - Intergenic
1158058705 18:53312940-53312962 GGGAGGGGAGGGAAGGGAGGAGG + Intronic
1158531757 18:58268967-58268989 CTGAGGCTTGGGAAGGGAGGAGG - Intronic
1159192410 18:65063080-65063102 CTGAGGCCAGTGAAAGAAGGAGG - Intergenic
1159218087 18:65423234-65423256 CCAAAAGTAGGGAAGGAAGGAGG - Intergenic
1160391480 18:78536741-78536763 AGGAAGGGAGGGAAGGAAGGAGG + Intergenic
1160429468 18:78801504-78801526 TGGAGGGTAGGGCAGGAACGAGG + Intergenic
1160523560 18:79522625-79522647 CTGAGGTGAGGGAAGGCTGGGGG - Intronic
1160648631 19:208157-208179 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1160650230 19:220973-220995 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1160785130 19:896749-896771 AGGAGGGGAGGAAAGGAAGGGGG + Exonic
1160960673 19:1719228-1719250 CTGAGGGGTGGGGAGGGAGGGGG + Intergenic
1161169893 19:2807419-2807441 CTGCGGGGAGGGCAGAAAGGTGG - Intronic
1161208938 19:3056388-3056410 ATGGGGGTGGGGAAGGATGGGGG + Intronic
1161259955 19:3332400-3332422 GGGAAGGAAGGGAAGGAAGGAGG - Intergenic
1161260055 19:3332720-3332742 GGGAAGGAAGGGAAGGAAGGAGG - Intergenic
1161260080 19:3332797-3332819 GGGAAGGAAGGGAAGGAAGGAGG - Intergenic
1161284033 19:3459659-3459681 GGGAGGGGAGGGAAGGGAGGAGG + Intronic
1161366256 19:3881428-3881450 CTGTGGGGTGGGGAGGAAGGGGG + Intronic
1161398840 19:4058875-4058897 CTGGAAGGAGGGAAGGAAGGCGG - Intronic
1161422640 19:4184302-4184324 CAGGAGGTAGGGGAGGAAGGAGG + Intronic
1161451730 19:4350124-4350146 CTGAAGGTGGGGAGGGAGGGAGG + Intronic
1161501026 19:4615799-4615821 AGGAGGGGAGGGCAGGAAGGGGG - Intergenic
1161620933 19:5296727-5296749 GGGAGGGGAGGGAAGGAATGGGG + Intronic
1161642932 19:5435672-5435694 CAGAGGGTGGGGAAGGGATGGGG - Intergenic
1161690166 19:5727825-5727847 CTGAGGGTAGTGGAGGATGTGGG + Intronic
1161846389 19:6713831-6713853 CTGGGGGTGGGGAAGGTGGGGGG - Intronic
1161852539 19:6745126-6745148 CGGACTGGAGGGAAGGAAGGCGG + Intronic
1162053668 19:8050382-8050404 CCGCGGGTTGGGAAGGTAGGGGG + Intronic
1162084779 19:8241964-8241986 CTGAGGGAAGGGAGGAAATGAGG - Intronic
1162171182 19:8790248-8790270 CTGAGGGGAGGGAGGGAGGGAGG + Intergenic
1162333055 19:10042224-10042246 CTGAGAGTGGAGAGGGAAGGAGG - Intergenic
1162924993 19:13926431-13926453 CTGGGGGAAGAGAAGGCAGGCGG + Intronic
1163677559 19:18662946-18662968 AGGAGGGCAGGGAAGGAAAGGGG - Intronic
1164471927 19:28543515-28543537 CCCGGGGTTGGGAAGGAAGGGGG + Intergenic
1164755882 19:30689114-30689136 CTGAGGCTTTGGAAGGAAAGAGG + Intronic
1164887871 19:31798677-31798699 CTGAGGACAGGAAAGGATGGAGG - Intergenic
1165031100 19:32998826-32998848 GTGAGGGGAGGAGAGGAAGGAGG + Intronic
1165101586 19:33441580-33441602 CTGAGTGAAGGGAAGGAACAGGG - Intronic
1165151034 19:33760279-33760301 AGGAAGGGAGGGAAGGAAGGAGG - Intronic
1165258701 19:34595822-34595844 CTGGGGGTGGGGAAGGCAGCAGG + Exonic
1165330971 19:35141086-35141108 GTGAGGGCAGGGAAGACAGGAGG - Intronic
1165339950 19:35204231-35204253 CTGAGGGGAGGCTAGGAAGAGGG + Intergenic
1165637573 19:37355102-37355124 CTGAGAAAGGGGAAGGAAGGAGG - Intronic
1165729444 19:38135361-38135383 CTCCGGGCAGGGTAGGAAGGTGG - Intronic
1165735697 19:38174078-38174100 CTGAGGCTGGGGAAGGATGCAGG + Intronic
1165741189 19:38206257-38206279 CTGAGGGGAAGGAGCGAAGGCGG - Exonic
1166040306 19:40198352-40198374 CTGTGGGGTGGGAAGAAAGGTGG - Intronic
1166283813 19:41811362-41811384 CTGGGGGCAGGGAGGGATGGGGG + Exonic
1166684805 19:44789981-44790003 CTGGGGGAAGGGAAGAGAGGGGG - Intronic
1166948082 19:46409243-46409265 GGGAGGGGAGGGAGGGAAGGAGG + Intergenic
1167144510 19:47673655-47673677 GGGAGGGGAGGGAAGGGAGGGGG - Intronic
1167415084 19:49365724-49365746 CTGTTGGGAGGGAAGGAGGGCGG + Intronic
1167468146 19:49660983-49661005 CTGATGGGAGGGAGGGAGGGAGG - Intronic
1167577598 19:50325301-50325323 CTGCGGGTAGTGGAGGAGGGAGG + Intronic
1168379731 19:55909870-55909892 CTCAGTGTAGGGAAGGAGGAGGG - Intronic
1168402148 19:56091594-56091616 CTGGGAGTGGGGAAGGCAGGAGG + Intronic
925034233 2:673719-673741 CAGAGGGGAGGGGAGGGAGGAGG + Intronic
925059625 2:880888-880910 CTGAGGCCAGGGAAGGAAAGCGG - Intergenic
925169736 2:1743628-1743650 CTGGGGGAGGAGAAGGAAGGGGG + Intronic
925199185 2:1952715-1952737 AGGAGGGAAGGGAAGGAAGGAGG - Intronic
925199191 2:1952732-1952754 GGGAGGGAAGGGAAGGAAGGAGG - Intronic
925199201 2:1952758-1952780 AGGAGGGAAGGGAGGGAAGGAGG - Intronic
925199234 2:1952857-1952879 AGGAGGGAAGGGAAAGAAGGAGG - Intronic
925199239 2:1952874-1952896 AGGAGGGAAGGGAAGGAAGGAGG - Intronic
925199256 2:1952927-1952949 AGGAGGGAAGGGAAGGAAGGAGG - Intronic
925221392 2:2144217-2144239 CTGAGGGCAGAGCAGGAGGGAGG - Intronic
925222879 2:2156670-2156692 CAGAGGTGAAGGAAGGAAGGAGG + Intronic
925253323 2:2461122-2461144 ATGAGGCTGGTGAAGGAAGGAGG - Intergenic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925515319 2:4674868-4674890 ATGGGGGTAGGGGAGGACGGGGG - Intergenic
925587666 2:5479480-5479502 CTCTGGGTAGGAAATGAAGGAGG + Intergenic
925913769 2:8589713-8589735 GAGAGGGGAGGGAAGGAAAGGGG + Intergenic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
926947706 2:18206179-18206201 AGGAAGGAAGGGAAGGAAGGAGG - Intronic
927003231 2:18821494-18821516 ATGGGGGGAGGAAAGGAAGGAGG + Intergenic
927134504 2:20086940-20086962 GCAAGGGTAGGGAAGGGAGGGGG - Intergenic
927877811 2:26670501-26670523 GTGGGAGAAGGGAAGGAAGGAGG + Intergenic
928166121 2:28973363-28973385 AGGAAGGAAGGGAAGGAAGGAGG - Intronic
928622768 2:33107914-33107936 CTGAGAGGAGGGAAGGGAGGAGG + Intronic
928921701 2:36534227-36534249 AGGAGGGTGGGGAAGGAGGGAGG + Intronic
929451993 2:42044112-42044134 GAGAGAGGAGGGAAGGAAGGAGG + Intergenic
929524911 2:42693113-42693135 GTGTGGGGAGAGAAGGAAGGAGG - Intronic
929559023 2:42944075-42944097 TCCAGGGTAGGGAATGAAGGAGG - Intergenic
929614065 2:43294526-43294548 ATGAGGCTAGGGAAGAAATGTGG + Intronic
929677187 2:43948200-43948222 CTGTGAGAAGGGAAGGGAGGGGG + Intronic
929918100 2:46153000-46153022 CAGAGGGGAGAGAAGGAATGAGG - Intronic
929950297 2:46405128-46405150 CTGGGGATAAGGATGGAAGGAGG - Intergenic
930086377 2:47500430-47500452 CTGAGTCGATGGAAGGAAGGAGG + Intronic
930221403 2:48750085-48750107 GTGAGGGTAGGCTAGGGAGGTGG + Intronic
930517363 2:52424734-52424756 AGGAGGGCAAGGAAGGAAGGAGG + Intergenic
930517379 2:52424776-52424798 AAGAGGGAAGGCAAGGAAGGAGG + Intergenic
930804214 2:55473919-55473941 CTGTGGGTAGAGGAGGAAGGGGG + Intergenic
931580531 2:63766990-63767012 GTGAGGGTGGGGCAAGAAGGTGG - Intronic
931589514 2:63866719-63866741 ATGAGGGTAGGCAAGGTAGTGGG + Intronic
932383991 2:71313705-71313727 GTGAGGGGAGGGAAGGGAAGGGG - Intronic
932688426 2:73892854-73892876 TTGGGGGTAGGGAAGGGGGGTGG - Intronic
932689066 2:73897070-73897092 GTGAGGGTGGGGAAGGCAGGGGG - Exonic
932900440 2:75692772-75692794 CTGAGGGTGTGGAAAGTAGGTGG + Intronic
933834338 2:86233023-86233045 CTGAGGGTAGGGAGGGATCCTGG - Intronic
934480114 2:94630514-94630536 CTTAGGGTAGGGAAAGAGAGTGG + Intergenic
934611802 2:95743911-95743933 CTCACTGTAGAGAAGGAAGGAGG + Intergenic
934767042 2:96885476-96885498 CTGAGGACAGGGAGGGAATGTGG + Intronic
934880447 2:97972449-97972471 GGGAGGGGAGGGAGGGAAGGCGG + Intronic
935077005 2:99755236-99755258 ATGAAGGTAGGGAGGGCAGGAGG - Intronic
935077145 2:99756188-99756210 ATGAAGGTAGGGAGGGCAGGAGG - Intronic
935103612 2:100019780-100019802 CTGAGGTGAGGGAAGGTTGGAGG - Intronic
935131301 2:100263119-100263141 AGGAGGGAGGGGAAGGAAGGAGG - Intergenic
935315129 2:101825424-101825446 CTGAGGGTAAGGAAAGTGGGTGG + Exonic
935438967 2:103069298-103069320 AGGAAGGAAGGGAAGGAAGGAGG - Intergenic
935597228 2:104888715-104888737 CTGAGAGTGGGGAAGGAAGTGGG - Intergenic
935698266 2:105788141-105788163 GTGAGAGTTGGGGAGGAAGGAGG + Intronic
935831529 2:107005699-107005721 CTGAAGCTAAGGAGGGAAGGAGG - Intergenic
936160314 2:110079830-110079852 CTGAGGGCAGGGAAGAATTGGGG + Intergenic
936184350 2:110291524-110291546 CTGAGGGCAGGGAAGAATTGGGG - Intergenic
936333931 2:111572928-111572950 GGGAGGGAAGGGAGGGAAGGAGG + Intergenic
936333943 2:111572961-111572983 GGGAGGGAAGGGAGGGAAGGAGG + Intergenic
936454879 2:112665408-112665430 TTGAGGGAAGGGAGGGTAGGGGG + Intergenic
936534096 2:113298090-113298112 CTGTGGGAAAGGAAGGAATGGGG - Intergenic
936545138 2:113385529-113385551 CTCACTGTAGAGAAGGAAGGAGG + Intergenic
936561611 2:113543418-113543440 GAGAGGGTTGGGAAGGAAGGAGG - Intergenic
936836425 2:116715805-116715827 CAGAGGGTGGGAAGGGAAGGAGG + Intergenic
937027641 2:118712363-118712385 GGGAGGGGAGGGGAGGAAGGAGG + Intergenic
937070198 2:119057407-119057429 CTGAGGGCAGGGAAGGCTGGGGG - Intergenic
937094437 2:119226221-119226243 CTGGGGCAAGGGAAGGAAGCAGG + Intronic
937339164 2:121079968-121079990 CTGAGGGTCTGGAGGGTAGGAGG + Intergenic
937347704 2:121136800-121136822 CAGAGGGTGGGGGAGGTAGGGGG + Intergenic
937821599 2:126316681-126316703 TTGTGGGGAAGGAAGGAAGGAGG - Intergenic
938183410 2:129206018-129206040 GAGAGGGAAGGGGAGGAAGGAGG + Intergenic
938707029 2:133940742-133940764 CTGAGGGTAAGTGAAGAAGGTGG + Intergenic
938780777 2:134582829-134582851 CTGAGAGGAGGAAAGGTAGGGGG + Intronic
939087295 2:137736770-137736792 CAGAGGAAAGGGTAGGAAGGGGG + Intergenic
939220205 2:139291940-139291962 ATGAGGGTGGCGAAGGAAGCAGG + Intergenic
939688446 2:145227877-145227899 GTGAGGGTGGAGAAAGAAGGGGG + Intergenic
940443034 2:153742918-153742940 CCAAGGGAAGGGAAGGAAAGGGG + Intergenic
940656148 2:156489889-156489911 AGGAGGGTAGTGAAGGAAGGAGG - Intronic
940656152 2:156489906-156489928 GGGAGGGGAGAGAAGGAAGGAGG - Intronic
940770560 2:157835197-157835219 CACAGTGTAGGGGAGGAAGGGGG - Intronic
941158595 2:162008983-162009005 AAGAGGGAAGGGAAGGAAGGAGG - Intronic
941180047 2:162248563-162248585 CTGAGGGTAAGAAAGGGAGATGG + Intergenic
941820447 2:169839355-169839377 CAGAGGGAAGGGTAGAAAGGAGG + Intronic
942106712 2:172640905-172640927 AGGAAGGGAGGGAAGGAAGGAGG - Intergenic
942181937 2:173388496-173388518 CAGAGGGTCTGGAAGGAAGCAGG + Intergenic
942231523 2:173864816-173864838 CTCAGGTTTAGGAAGGAAGGTGG + Intergenic
942458806 2:176155638-176155660 CTTAGGGCAGGGAAGGAAATGGG + Intronic
942494535 2:176525935-176525957 CTCAGGGTAGAGAAAGCAGGGGG - Intergenic
942639750 2:178048860-178048882 TTCAGGGTAGGGAAGAAAGAAGG + Intronic
943499242 2:188666161-188666183 AGGAGGGAAGGGAGGGAAGGAGG - Intergenic
943662531 2:190574776-190574798 GGGAGGGAAGGGAGGGAAGGAGG - Intergenic
943708079 2:191057170-191057192 CAGAGGCTAGGAAAGGAAGCAGG - Intronic
943784737 2:191864865-191864887 ATGAGGGTTGGAAAGGTAGGAGG - Intergenic
944440841 2:199742011-199742033 CGGAGGGTAGGAAATGAAGCTGG - Intergenic
944581501 2:201136894-201136916 CTGAGGAGAGGGCAGGAATGGGG + Intronic
944822444 2:203444080-203444102 GTGAGGGGAGGGAGGAAAGGAGG + Exonic
944951613 2:204756907-204756929 AGGAGGGGAGGGAAGAAAGGAGG - Intronic
945212100 2:207394437-207394459 CTGAGGTTACAGAAGGAAGGAGG + Intergenic
945240808 2:207675223-207675245 ATGAGGGTAGGGGCTGAAGGTGG + Intergenic
945308863 2:208287199-208287221 CTGAGGGAAGGGAAGGGATTAGG + Intronic
945876133 2:215279898-215279920 AGGAAGGAAGGGAAGGAAGGAGG + Intergenic
945892843 2:215448601-215448623 CTGAAGGGAGGGCAGGAAAGTGG + Intergenic
946273830 2:218615806-218615828 CTCAGGGAAGGGAAGGAGGTTGG + Intronic
946353078 2:219168361-219168383 CTGAGGGATGGGAAAGGAGGTGG + Intronic
947382583 2:229559627-229559649 CAGAAGAAAGGGAAGGAAGGAGG + Intronic
947594051 2:231399847-231399869 ATGAGGGGAGGGAAGGGAGGAGG - Exonic
947897198 2:233686730-233686752 GTGAGGCTAGGGAAGGCAAGAGG - Intronic
948005682 2:234605728-234605750 CTGAGGGTAGCGGATGAGGGTGG - Intergenic
948186361 2:236024469-236024491 GCGAGGGGAGGGAAGGAGGGAGG - Intronic
948326917 2:237131860-237131882 CTGAGGGTGGGGAGGGGAGCAGG - Intergenic
948388979 2:237598574-237598596 ATGAGGGTAGGGAAGGGGGCGGG - Intronic
948408829 2:237743287-237743309 CAGAGGGGAGGGAGGGAGGGTGG + Intronic
948458011 2:238116258-238116280 AAGAGGGGAGGGAAGGAAGCTGG - Intronic
948646912 2:239411136-239411158 ATGAGGGAAGGTAGGGAAGGTGG - Intergenic
948716242 2:239865407-239865429 CTGAGGGATGGGGAGGGAGGGGG - Intergenic
948768933 2:240237549-240237571 GTGGGGGTGGGGAAAGAAGGTGG - Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948869256 2:240790087-240790109 CTGGGGGCAAGGATGGAAGGTGG - Intronic
948908600 2:240991785-240991807 CTGAGGGCACGGAATGAAGCCGG - Intronic
1168743144 20:212126-212148 CTGTAGGTAGAGAAAGAAGGAGG + Intergenic
1168831185 20:846059-846081 CAGAGGCCAAGGAAGGAAGGAGG - Exonic
1168866737 20:1092994-1093016 CTGCTGTTAGGGCAGGAAGGTGG + Intergenic
1169661584 20:7984260-7984282 CTGTGGGTGGGGAAGGATTGAGG + Intronic
1170880994 20:20296315-20296337 AGGAAGGAAGGGAAGGAAGGAGG - Intronic
1171022879 20:21602698-21602720 CTGTGGGTAGGGAGGGCTGGAGG + Intergenic
1171990729 20:31694330-31694352 ATGGGGGTGGGGAAGGAAGTGGG + Intronic
1172115959 20:32573861-32573883 CTGAGGGGAGAGAAGAAGGGAGG - Intronic
1172189962 20:33056021-33056043 CTGTGGGAAGGGCAGGATGGAGG - Intronic
1172780700 20:37435586-37435608 GTGAGGGTAGGTAAAGCAGGAGG - Intergenic
1172963225 20:38813454-38813476 CTGATGGAAGGGAAGGTGGGAGG + Intronic
1173068444 20:39737219-39737241 CAGGGGGTGGGGAAGGGAGGAGG - Intergenic
1173189396 20:40864641-40864663 CTGAAGGAAGGGATGGAGGGAGG + Intergenic
1173312851 20:41916126-41916148 CTGCGGGTGGGGAAGTTAGGTGG + Intergenic
1173854025 20:46238177-46238199 CTGATGCTAGAGAAGGAAGCAGG - Intronic
1173988156 20:47278921-47278943 CTGAGGCTAGCTCAGGAAGGGGG - Intronic
1174088321 20:48026374-48026396 CAAAGGGAAGGGAAGGAAAGGGG - Intergenic
1174547174 20:51334303-51334325 AGGAGGGAAGAGAAGGAAGGAGG + Intergenic
1174819114 20:53712167-53712189 AGGAAGGGAGGGAAGGAAGGAGG - Intergenic
1175019310 20:55827450-55827472 CTAAAGGAAGGGAAGGAAAGGGG - Intergenic
1175283493 20:57820987-57821009 CAGAGGGCAGGGGTGGAAGGGGG + Intergenic
1175369502 20:58478421-58478443 ATGAGGGAAGGGAAGGGAAGGGG - Intronic
1175592145 20:60201639-60201661 CTGAGAGTAGGGAAGGGGTGAGG + Intergenic
1175663426 20:60837158-60837180 TGGAGGGTAGGAGAGGAAGGAGG - Intergenic
1175758976 20:61548308-61548330 CTGAGGCTCGGGCAGGCAGGTGG + Intronic
1175961032 20:62636438-62636460 GTGCGGGTAGGGAGGGGAGGTGG + Intergenic
1175974777 20:62705222-62705244 CTGAGGGAAGAGAAGGTTGGAGG + Intergenic
1175984180 20:62755787-62755809 CTGAAGGGAGGGATGGAGGGAGG - Intronic
1177113002 21:17050902-17050924 CTGTGGGGAGGGAAGTGAGGTGG + Intergenic
1177567108 21:22838177-22838199 GAGGGGGAAGGGAAGGAAGGGGG + Intergenic
1177617738 21:23545942-23545964 TAGAGGGGAGGGTAGGAAGGGGG + Intergenic
1177817808 21:25997321-25997343 CTGAGGGAAGGGAAGAGGGGAGG - Intronic
1178701097 21:34834630-34834652 ATGGGGGGAGGGAAGGAGGGAGG + Intronic
1178722677 21:35023704-35023726 CTGAGGGTGGGAAATGAAAGGGG + Intronic
1178820780 21:35973164-35973186 CTTAGCCTTGGGAAGGAAGGTGG - Intronic
1178961762 21:37072734-37072756 CGGAGGATAGGGCAGGGAGGGGG + Exonic
1179104094 21:38383271-38383293 CTGGGGCTGGGGAAGGAAGCCGG - Exonic
1179116058 21:38493801-38493823 CACAGGACAGGGAAGGAAGGAGG - Intronic
1179170882 21:38971898-38971920 CGGAGAGTAGGGAAGGGAGAGGG - Intergenic
1179215889 21:39366875-39366897 AGGAGGGAAGGGAAGGGAGGAGG - Intergenic
1179228302 21:39476184-39476206 TGGAGAGTAGGGAAGGCAGGAGG + Intronic
1179296511 21:40067720-40067742 ATGAGGGGAGGGAGGGAATGAGG - Intronic
1179296818 21:40070239-40070261 AGGAAGGTAGGGAAGGAGGGAGG + Intronic
1179296845 21:40070330-40070352 AGGAAGGTAGGGAAGGAGGGAGG + Intronic
1179471383 21:41612995-41613017 CAGAGGGCAGGGAAGGAATCTGG - Intergenic
1179498393 21:41790551-41790573 CTGAGGCTAGGGAATGGGGGAGG + Intergenic
1179682349 21:43032309-43032331 CGGAGGGTGGTGAGGGAAGGAGG - Exonic
1179837719 21:44048322-44048344 CAGAGGGTGGGGAGGGCAGGGGG - Intronic
1179963289 21:44784175-44784197 GGGAGGGGAGGGAAGAAAGGAGG + Intronic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180224718 21:46385460-46385482 CTGAGGCTAGGGGAGGGAAGGGG - Intronic
1181002284 22:19993495-19993517 CTGGGGGAAGGCTAGGAAGGGGG + Intronic
1181067214 22:20312601-20312623 AGGAGGGTAGGGAAGGCAGGAGG + Intergenic
1181528277 22:23502285-23502307 ATCAGGGTATGGAAGGATGGGGG - Intergenic
1181568204 22:23752264-23752286 CTGAGGGTGCTGAAGGCAGGTGG - Intergenic
1181627748 22:24133090-24133112 CTCAGGGTGGGGCAGGCAGGGGG + Intronic
1181736085 22:24882664-24882686 CAGAGGGTAGGAAGGGAAGGAGG - Intronic
1181844761 22:25698199-25698221 AGGAAGGGAGGGAAGGAAGGAGG + Intronic
1182013900 22:27023026-27023048 CTGGGGCTAGGGAGGGAGGGAGG + Intergenic
1182074007 22:27482615-27482637 CAGAGGGTTGGGAAGGAACCTGG + Intergenic
1182096260 22:27627973-27627995 CTGAAGCTAAGCAAGGAAGGAGG + Intergenic
1182123934 22:27802918-27802940 GTGTGTGTAGGGAAGGAGGGGGG + Intergenic
1182351795 22:29703794-29703816 CTCAGGGCAGGGAAGGTATGGGG + Intergenic
1182458828 22:30470124-30470146 CTGAGAACAGGGATGGAAGGAGG + Intronic
1182556979 22:31134416-31134438 CTGAGGGTGGGGTAGGCAGATGG + Exonic
1182624928 22:31638597-31638619 CAGAGGCTAGGGAAGGATGGGGG - Intronic
1182676562 22:32043657-32043679 CTGTGAGCAGAGAAGGAAGGTGG + Intronic
1182727084 22:32456447-32456469 ATGAGGGAAGGGAGGGAGGGAGG - Intronic
1183209709 22:36443352-36443374 AGGAAGGGAGGGAAGGAAGGAGG - Intergenic
1183209720 22:36443380-36443402 AGGAAGGGAGGGAAGGAAGGAGG - Intergenic
1183698825 22:39438240-39438262 GAGAAGGGAGGGAAGGAAGGAGG - Intergenic
1183785856 22:40028735-40028757 CTGCCTGTAGGGAGGGAAGGGGG - Intronic
1184103368 22:42353396-42353418 TGGAGAGTAGGGAAGGAAGGAGG + Intergenic
1184275042 22:43405227-43405249 CTGAGGGTGGGGAGGGCCGGAGG + Intergenic
1184303453 22:43577839-43577861 CTTGGTGTAGGGAAGCAAGGTGG - Intronic
1184645985 22:45895776-45895798 CTGAGGTCAGGCAGGGAAGGTGG + Intergenic
1184690568 22:46115490-46115512 TGGAGGGTAGGGAGGGAAGTGGG - Intergenic
1184931413 22:47683937-47683959 AGGAGGGTGGGGAAGGAAGAGGG - Intergenic
1184977633 22:48074163-48074185 CTGAGGATCAAGAAGGAAGGTGG - Intergenic
1185013758 22:48331771-48331793 CTGAGGGATGGGAAGAGAGGAGG + Intergenic
1185031163 22:48443690-48443712 GGGAAGGGAGGGAAGGAAGGTGG + Intergenic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
1185229824 22:49673587-49673609 CAGAGGGGGGGGAAGGGAGGAGG + Intergenic
1185292169 22:50032633-50032655 CTGACGGCTGGGCAGGAAGGGGG - Intronic
1185355027 22:50363251-50363273 CTAAGTGTAAGGAAGGAAGCTGG - Intronic
1185391035 22:50562048-50562070 CTGAGGTGAGGGATGTAAGGTGG + Intronic
1203322947 22_KI270737v1_random:86267-86289 ATGAGGGAAGGGAGGGAGGGAGG - Intergenic
949121258 3:387323-387345 CAGAGGGAAGGGAAGGCTGGTGG + Intronic
949934602 3:9106945-9106967 CTGGGGCTTGGGAAGGTAGGTGG + Intronic
949986159 3:9542907-9542929 CTTAGGGCTGAGAAGGAAGGAGG + Intronic
950144621 3:10640247-10640269 CTGAAGGTAGGGAATGATTGGGG + Intronic
950156272 3:10723765-10723787 CTGAGTGTTGGGAAGGAGGGTGG + Intergenic
950525482 3:13520507-13520529 CTGAGGGTCGGGAAGGAGGTGGG - Intergenic
950569082 3:13788903-13788925 CCTAGGGCAGGGAAGGAAGTGGG + Intergenic
950654341 3:14427467-14427489 CAGAGGCCTGGGAAGGAAGGCGG - Intronic
950958428 3:17079592-17079614 CTCAGGGCAGGAAAGGACGGCGG - Intronic
950967059 3:17153937-17153959 CTGAGGGGAAGGCAGGTAGGTGG - Intergenic
951053971 3:18126215-18126237 ATGAAGGGAGGGAAGGAGGGAGG - Intronic
951426582 3:22553076-22553098 CTGTGGGAAGGGAAGGCAAGGGG + Intergenic
951709318 3:25573175-25573197 GAGTGGGCAGGGAAGGAAGGCGG - Intronic
952212868 3:31247119-31247141 CTGAGGGTAGCGGAGGAGGAAGG - Intergenic
953289745 3:41649465-41649487 CTGAGCGTAGGGGTGGCAGGGGG - Intronic
953826145 3:46252600-46252622 ATGAAGGAAGGGAAGGAAGTGGG + Intronic
954349096 3:50027498-50027520 CTGGGGGTAGAGAAGGAAGTAGG - Intronic
954384405 3:50236763-50236785 CAAAGTGTAGGGAAGGATGGCGG - Intronic
954460826 3:50625921-50625943 GTGGGGGTGGGGAAGGAAGGAGG + Intronic
954735993 3:52706735-52706757 CTGAGGGTTGGGAGGGAGGCGGG - Intronic
954841745 3:53517422-53517444 TGAAGGGTAGGGAAGGAGGGAGG - Intronic
955884813 3:63586492-63586514 CTGGGGATAGGGATGGAAGAAGG - Intronic
956067952 3:65416997-65417019 TTGAGGGAAATGAAGGAAGGTGG + Intronic
956643440 3:71435374-71435396 GGGAGGGAAGGGAAGGAGGGAGG + Intronic
956871058 3:73418663-73418685 CATAGGGTGGGGAAGGACGGGGG - Intronic
957080746 3:75633837-75633859 CAGAGAGTAGGGAAGGAAGTCGG - Intergenic
957257524 3:77857306-77857328 CAGAGGCTGGGGAAGGATGGAGG + Intergenic
957262872 3:77922947-77922969 CTTTGGTTAGGGAAGGAAGTGGG - Intergenic
957440385 3:80238847-80238869 GTGAAGGCAGGAAAGGAAGGAGG - Intergenic
957442783 3:80272132-80272154 CTGAAGGAAGGGAGGGAGGGAGG + Intergenic
957872801 3:86110180-86110202 CTCAGGGTAAGGAACTAAGGAGG - Intergenic
957989882 3:87614441-87614463 GTGTGGTTAGGGAAGGCAGGGGG + Intergenic
958188035 3:90148252-90148274 TTGAAGATAGGGAAGGAAGTAGG - Intergenic
958410555 3:93810077-93810099 TTGAAGATAGGGAAGGAAGTAGG - Intergenic
958456865 3:94343366-94343388 AGGAAGGGAGGGAAGGAAGGAGG - Intergenic
958513929 3:95088135-95088157 CTGAGGGTGAGAAAGGAAGGAGG - Intergenic
959145205 3:102535676-102535698 GAGAGAGTAGGGAAGGCAGGAGG - Intergenic
959188517 3:103079031-103079053 CAGAGGTTAGGGATGAAAGGAGG - Intergenic
959189079 3:103086562-103086584 CTGAGGGATGGGAAGGTTGGAGG - Intergenic
959256846 3:104025832-104025854 CAGGGGGCAGGGAGGGAAGGAGG + Intergenic
959575591 3:107929495-107929517 TTGAGGGTTGGGACAGAAGGTGG - Intergenic
959897537 3:111621354-111621376 GAGAAGGTAGGGGAGGAAGGAGG + Intronic
960882570 3:122360513-122360535 CAGAGGGAAGGGAAAGTAGGAGG + Intronic
961074699 3:123971485-123971507 CAGAGGAGAGGAAAGGAAGGTGG - Intronic
961175835 3:124834500-124834522 GGGAGAGGAGGGAAGGAAGGAGG + Intronic
961308982 3:125980993-125981015 CAGAGGAGAGGAAAGGAAGGTGG + Intronic
961340210 3:126212601-126212623 CGGGAGGAAGGGAAGGAAGGAGG + Intergenic
961530182 3:127535929-127535951 CTGAGTGTGGGGAAGACAGGAGG - Intergenic
961597456 3:128029870-128029892 CAGAGGCTGGGGAAGGAATGGGG - Intergenic
961624664 3:128253636-128253658 GTGAGGAGAGGGAAGGAAAGAGG - Intronic
961816206 3:129551753-129551775 CTGAGGGGTGGGATGAAAGGAGG + Intergenic
961943557 3:130661859-130661881 CTGAGTGTTGGGTAGGAAGTCGG - Exonic
961995004 3:131233105-131233127 AGGAAGGTAGGGAAGGAGGGAGG + Intronic
962438141 3:135385134-135385156 GTAAGGATAGGGAAGGCAGGTGG + Intergenic
962662613 3:137619038-137619060 CTAAGGATGGAGAAGGAAGGTGG + Intergenic
962791382 3:138814620-138814642 TTGAGTGGAGGAAAGGAAGGTGG - Intronic
963202642 3:142600425-142600447 GTGAGGGTAGGCCAGGAGGGTGG + Intronic
963237617 3:142971190-142971212 ATGTGGGTAGGGAAGGAAAATGG + Intronic
963291745 3:143497316-143497338 CTGAGAGTAGGGAATGAAGTGGG - Intronic
963512398 3:146264078-146264100 CTTTGGGTAGAGAAGGAAAGAGG + Intergenic
963591719 3:147269431-147269453 CTGAGGTTAGGGGAGGAGTGAGG - Intergenic
963769824 3:149378566-149378588 ATGGGGGGAGGGAAGGAAGGAGG + Intergenic
963863040 3:150330438-150330460 GGGAAGGAAGGGAAGGAAGGAGG + Intergenic
963934170 3:151035402-151035424 CTGGGGGAAGGAAAGGTAGGAGG - Intergenic
964277926 3:155027476-155027498 CTGAGGGCAGGGAAGGTGGTTGG - Intronic
964738589 3:159942106-159942128 GGAAGGGAAGGGAAGGAAGGAGG + Intergenic
965903688 3:173675684-173675706 GTGTGGGTTGGGAAGAAAGGAGG + Intronic
965961983 3:174440253-174440275 CTGAAGCGAGGGAAGGAAGAAGG - Intronic
966283958 3:178270888-178270910 CTCAGGGTTGGGAAGGAGGAAGG + Intergenic
966349052 3:179011233-179011255 GTGAGGGGAGGGGAGGAAGTGGG + Intergenic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
966902029 3:184493491-184493513 CACAGGGTAGGAAAGGAAGGAGG + Intronic
967054754 3:185822835-185822857 CTGGGGGTAGGGGCGGGAGGTGG + Intronic
967356479 3:188577802-188577824 GGGAGGGGAGGGGAGGAAGGAGG - Intronic
967446878 3:189577654-189577676 AGGAGGGAAGGGAGGGAAGGAGG - Intergenic
967681218 3:192366153-192366175 CTGAGGGTTGGGGAGCAAGAAGG + Intronic
967899980 3:194440054-194440076 ATGTGGGTAGGGAGGGAGGGAGG + Intronic
967954707 3:194869280-194869302 CTGAGGGAGGGGAAGGAAAGGGG + Intergenic
968248469 3:197180413-197180435 CTGAGGGTGCGGAACCAAGGAGG + Intronic
968367616 3:198199156-198199178 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
968369218 3:198211958-198211980 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
968555431 4:1244417-1244439 CTGAGGCTGGGGAAGGAACAGGG - Intronic
968946557 4:3667632-3667654 AGGAAGGCAGGGAAGGAAGGAGG + Intergenic
969172543 4:5375877-5375899 AGGAGGGCAGGGAAGGAAGTAGG + Intronic
969545560 4:7824748-7824770 CTGAGGGAACGGGAGGAAGGGGG + Intronic
969717966 4:8877540-8877562 AGGAGGGGAGGGATGGAAGGAGG + Intergenic
970161292 4:13192096-13192118 AGGAGGGAAGGGAAGGAAGTGGG + Intergenic
970365088 4:15350208-15350230 AGGAAGGGAGGGAAGGAAGGAGG + Intronic
970365118 4:15350305-15350327 GGGAAGGGAGGGAAGGAAGGAGG + Intronic
970539973 4:17067866-17067888 CTAAGGGTAGGGAATGAGGGAGG - Intergenic
970672399 4:18411972-18411994 ATGAGAGGAGGGAAGGAAGGAGG - Intergenic
970894156 4:21083283-21083305 CTGAGGAGGGGGAAGGAAAGAGG - Intronic
970979781 4:22082749-22082771 CAGAGGATAGGAAAGGAAGTAGG - Intergenic
971059993 4:22957093-22957115 CTGATTGGAGGGAAGGAAGGTGG + Intergenic
971185767 4:24374402-24374424 CAGAGGGTGGGGGTGGAAGGAGG + Intergenic
971400289 4:26269775-26269797 TTGAGGGAAGGGAGTGAAGGGGG + Intronic
971563102 4:28106264-28106286 GGGAGGGAAGGGAAGGAGGGAGG + Intergenic
972575023 4:40343624-40343646 CTGAGGAAAGGGAAGGTAAGAGG + Intronic
972645334 4:40962721-40962743 GTGGGGGAAGGGAGGGAAGGAGG + Intronic
972693209 4:41419802-41419824 AAGAGGGAAGGGAAGAAAGGAGG - Intronic
972738232 4:41866054-41866076 CTGGGGTTGGGGAAGGCAGGTGG - Intergenic
972993377 4:44850068-44850090 TTAAGGGAAGGGAAGGAAGTTGG + Intergenic
973173477 4:47174855-47174877 GGGAGGGAAGGGAGGGAAGGAGG - Intronic
973639773 4:52891352-52891374 CAGTGGGTAAGTAAGGAAGGTGG + Intronic
975738477 4:77405042-77405064 CACAAAGTAGGGAAGGAAGGAGG + Intronic
976281209 4:83328681-83328703 CCGAGGGGAGGGAAGAAACGGGG + Intronic
976297112 4:83483706-83483728 CTCAGGGAAGGGAAGCAGGGGGG + Intronic
976653014 4:87456328-87456350 CTAAGGATTGGGGAGGAAGGAGG - Intronic
976778926 4:88737404-88737426 CGGAGGGGAGGGGAGGAGGGAGG + Intronic
977188090 4:93965900-93965922 CAGAGGGTGGGGAAGACAGGGGG - Intergenic
977416878 4:96744206-96744228 AGGAGGGAAGGGAAGGAGGGAGG - Intergenic
977433360 4:96960899-96960921 CTGAGGATGGGGAAGGAATATGG - Intergenic
977705383 4:100064887-100064909 CAGAGAGAAGGGAAGGAGGGAGG - Intergenic
978081274 4:104594856-104594878 ATAAGGGTAGTGAAGAAAGGTGG + Intergenic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
978243804 4:106548836-106548858 GGGAGGGAAGGGAGGGAAGGAGG - Intergenic
978872594 4:113597903-113597925 CTGAGGAAAGGGAAAGAATGGGG + Intronic
978978790 4:114915841-114915863 GAGAGGGAAGGGAAGGAAGAGGG + Intronic
979256031 4:118608868-118608890 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
979257643 4:118621686-118621708 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
979330704 4:119418876-119418898 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
979332313 4:119431669-119431691 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
980568891 4:134584132-134584154 AAGAGGGGAGGGAAGGAAAGAGG - Intergenic
980741561 4:136956314-136956336 GTCAGGGTAGGGAAGGGAGGTGG + Intergenic
980980684 4:139652238-139652260 CTGAGAGTTGGGAGGGCAGGAGG + Intergenic
981046876 4:140272802-140272824 ATTTGGGTGGGGAAGGAAGGCGG + Intronic
981117928 4:141013972-141013994 CTCAGGGGAGGGAGGGAATGGGG - Intronic
981212446 4:142124067-142124089 TTGGGTGTAGGCAAGGAAGGTGG + Intronic
981413333 4:144458743-144458765 ATGAAGGCAGGGAAGGAGGGAGG + Intergenic
982167522 4:152628288-152628310 CTGAGGGTGGAGAAGGAGGCGGG - Exonic
982468894 4:155762227-155762249 CAGAGGGTAGGGAGGGGAGGAGG - Intronic
982492511 4:156046587-156046609 GGGAGGGGAGGGGAGGAAGGAGG - Intergenic
983293918 4:165841158-165841180 CTGGAGGAAGGGAAGAAAGGGGG + Intergenic
983649004 4:170020285-170020307 CTCAGGGCAGGGAAGGAAAGGGG - Intronic
983763230 4:171440441-171440463 CTGAGTGTAGGGGCAGAAGGGGG - Intergenic
984517616 4:180760412-180760434 CTAAGGCGAGGTAAGGAAGGAGG + Intergenic
984613500 4:181868260-181868282 CTGGGGTGAGGGAAGGGAGGTGG - Intergenic
984764702 4:183391098-183391120 AGGAAGGAAGGGAAGGAAGGAGG - Intergenic
984979929 4:185270678-185270700 CTGGAGGGAGGGAAGGAATGGGG - Intronic
985273548 4:188216612-188216634 AAGGGGGTAAGGAAGGAAGGAGG - Intergenic
985434413 4:189915268-189915290 CTCAGGGTAGGCAGGTAAGGTGG - Intergenic
985450164 4:190057372-190057394 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
985648533 5:1096690-1096712 GGGAAGGGAGGGAAGGAAGGAGG + Intronic
985648551 5:1096734-1096756 GGGAAGGGAGGGAAGGAAGGAGG + Intronic
985648584 5:1096815-1096837 GGGAAGGGAGGGAAGGAAGGAGG + Intronic
985648618 5:1096903-1096925 AGGAAGGGAGGGAAGGAAGGAGG + Intronic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
986051454 5:4094260-4094282 CTGATGGTTGGGAAGGAATGTGG + Intergenic
986233230 5:5885670-5885692 ATGAGGGTAAGGGTGGAAGGGGG + Intergenic
986283978 5:6346517-6346539 GTGAGAGGAGGGAAGGAAGGAGG + Intergenic
986310025 5:6544785-6544807 CTGAGGGTGGGGACGGTGGGGGG - Intergenic
986711220 5:10489277-10489299 GGGAGGGGAAGGAAGGAAGGAGG + Intergenic
987872594 5:23640281-23640303 TTGGAGGGAGGGAAGGAAGGAGG - Intergenic
989001654 5:36766914-36766936 GAGATGGTAGGAAAGGAAGGAGG + Intergenic
989272598 5:39550544-39550566 CAGAAGAGAGGGAAGGAAGGAGG + Intergenic
989592012 5:43121085-43121107 CTGAGGGACGGAGAGGAAGGAGG + Intronic
989697717 5:44223157-44223179 ATGAGGGGAGGGAGGGAGGGAGG + Intergenic
990241455 5:53820207-53820229 CTGAGGGGAGGAAGGGAGGGAGG + Intergenic
990287213 5:54311662-54311684 CTGAGGGTGGGGATGGGGGGGGG - Intergenic
991326485 5:65438949-65438971 CTGAGGATAGGGAAGAGAGGAGG - Intronic
992135115 5:73736840-73736862 GTGAGGGGAGGGAGGGAGGGAGG + Intronic
992187680 5:74259888-74259910 CTGAGGGTAGGGAATGGAGGTGG - Intergenic
992262172 5:74982302-74982324 CTGCTGGTAGGGAAGTAACGTGG + Intergenic
994732087 5:103504459-103504481 CTGAGGATAGGGAGGTGAGGGGG - Intergenic
995296282 5:110527082-110527104 CCGAGGATAGGGAGGGATGGGGG + Intronic
995389534 5:111625337-111625359 CAGAGGCTATGGAAGTAAGGAGG + Intergenic
995705497 5:114985046-114985068 CTGATGGTAGAGAAGCCAGGTGG - Intergenic
995721919 5:115144342-115144364 CTGAGGGAAGAGAAGGATGAAGG - Intronic
995801683 5:116003471-116003493 GTGAGGGGCGGGAATGAAGGTGG - Intronic
995867801 5:116710220-116710242 CTGAGAGAAGGGAATGAATGAGG + Intergenic
996111723 5:119573598-119573620 CTAATGATAGGGAAAGAAGGTGG + Intronic
996228736 5:121034281-121034303 GTGAGGGTGGGGAAGCAAGCAGG + Intergenic
996410522 5:123153945-123153967 TTGAGGGAAGGGAGGGTAGGGGG + Intronic
996765946 5:127034108-127034130 GGGAGGAAAGGGAAGGAAGGAGG - Intergenic
996766500 5:127039598-127039620 CTGGGGATGGGGAAGGATGGAGG + Intergenic
996815114 5:127565869-127565891 CTGAGGGGAGGGGAGGATGGTGG - Intergenic
997264254 5:132485951-132485973 CTGAGGGTGAGGAAGGAAGTAGG - Intronic
997266130 5:132496380-132496402 CTGGGGGTAGGGGTGGAAGTGGG - Intergenic
997431137 5:133842034-133842056 TTTAGAGGAGGGAAGGAAGGTGG - Intergenic
997435179 5:133868502-133868524 CAGGGGGTGGGGAAGGGAGGGGG + Intergenic
997643895 5:135467499-135467521 CAGAGGGTAGGGTGGGGAGGAGG + Intergenic
997884496 5:137617871-137617893 ATGAGGGGAGGGGAGGATGGGGG + Exonic
997887527 5:137643885-137643907 CAGAGGCTGGGGAAGGGAGGAGG - Intronic
998107279 5:139476555-139476577 CTGGGGCTTGGGTAGGAAGGGGG - Intronic
998164253 5:139833656-139833678 CTAAGAGTAGGGAAGGAGGCTGG - Intronic
998243157 5:140469094-140469116 GAGAAGGGAGGGAAGGAAGGAGG - Intronic
998708352 5:144791477-144791499 CCGGGGGAAGGGAAGGAAGAGGG - Intergenic
998913657 5:146991409-146991431 CAGAGGCTAGGGATGGGAGGCGG + Intronic
999092634 5:148950760-148950782 CAGAGTAGAGGGAAGGAAGGGGG - Intronic
999195162 5:149776944-149776966 CTGAGGGTGGGGAAGGACTCGGG - Intronic
999467601 5:151822420-151822442 CTGAGGGCTGGGAGGAAAGGAGG - Intergenic
999698949 5:154210488-154210510 CTGAGGGTTGGGGTAGAAGGGGG - Intronic
999796429 5:154993729-154993751 CGGAGGGGAGGGAAGGGGGGAGG - Intergenic
999854587 5:155580265-155580287 CTGAGGGCTGGGAAGGTTGGTGG - Intergenic
1000125468 5:158239547-158239569 CTGGGGGTGGGGAAGGACTGGGG - Intergenic
1000257766 5:159557198-159557220 CTGAGGTCAGGGAAGCGAGGAGG - Intergenic
1000330977 5:160204962-160204984 CTGGGGGTTGGAAAGAAAGGGGG + Intronic
1000607031 5:163336848-163336870 CTTTGGGTTGGGAAGAAAGGTGG - Intergenic
1000935359 5:167299472-167299494 ATGTGTGTAGGGAAGGGAGGGGG + Intronic
1001049352 5:168402146-168402168 CAGAGGGAGGGGAAGAAAGGAGG - Intronic
1001106071 5:168855713-168855735 CTGGGGGCAGGGAGGGAATGGGG + Intronic
1001106201 5:168856840-168856862 CTCAGAGAAGGCAAGGAAGGAGG + Intronic
1001240086 5:170062221-170062243 CTCAGGGTAAGGGAGTAAGGAGG + Intronic
1001412939 5:171523747-171523769 CTCGGAGAAGGGAAGGAAGGAGG - Intergenic
1001966569 5:175913992-175914014 CAGAGGGTAGTGAGGGGAGGGGG - Intergenic
1002027005 5:176402576-176402598 CTCATGGCAGGGAGGGAAGGGGG - Intronic
1002250378 5:177925212-177925234 CAGAGGGTAGTGAGGGGAGGGGG + Intergenic
1002344372 5:178537263-178537285 CTGAGGGTGCGGCAGGGAGGGGG - Intronic
1002726839 5:181304385-181304407 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1002728496 5:181317543-181317565 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1002813071 6:652701-652723 CTGGGGGTGGGGAAGGGAAGAGG + Intronic
1002819975 6:716025-716047 TTAAGGGCTGGGAAGGAAGGAGG - Intergenic
1002825642 6:771079-771101 CAGAGAGAAAGGAAGGAAGGAGG - Intergenic
1002917716 6:1542186-1542208 AGGAGGGGAGGGAAGGAGGGAGG + Intergenic
1003130664 6:3392756-3392778 CTGAGGATGTGGGAGGAAGGAGG + Intronic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003637297 6:7844601-7844623 CTGCGGGTGGGGAAGGGGGGTGG - Intronic
1003674717 6:8192669-8192691 CTGAGTGGAGCCAAGGAAGGGGG + Intergenic
1003763059 6:9203821-9203843 CTGAAGGGAGGGAAAGAAAGAGG + Intergenic
1003773641 6:9335745-9335767 GGGAGGGTAGGGAGGGAAGCAGG - Intergenic
1003822717 6:9917920-9917942 CTGAGAGTAGGGAAGGAAAATGG - Intronic
1003872204 6:10412419-10412441 GAGAGGGGAGGGAGGGAAGGAGG + Intronic
1004179333 6:13367456-13367478 ATGGGGGTCGGGAAGGAAGCAGG - Intronic
1004396039 6:15247442-15247464 TTGAGGGGAGGGAGGAAAGGGGG + Intronic
1004903239 6:20212541-20212563 CCGAGAGGAGGGAAGGAGGGAGG + Intergenic
1004934855 6:20497165-20497187 GGGAGGGGAGGGAAGGAGGGAGG + Intergenic
1005714074 6:28530485-28530507 CTGAAGGGAGGGGAAGAAGGTGG - Intronic
1005777110 6:29146238-29146260 CTGGGGCAGGGGAAGGAAGGGGG - Intergenic
1005841681 6:29748172-29748194 CTGAGGGCAGGGGAGGAGGTGGG + Intergenic
1005987017 6:30881946-30881968 CTGAGGCCAGGGAGCGAAGGAGG - Intronic
1006175240 6:32117451-32117473 CTGTGGGTGGGCAAGGAGGGTGG - Intronic
1006459575 6:34150606-34150628 CTGAGGCTGGGGAAGGAAAGAGG - Intronic
1006459590 6:34150671-34150693 CTGAGGCTGGGGAAGGGAAGTGG - Intronic
1006519534 6:34563317-34563339 CTGAGGGTAGGGAGGGTAGTGGG + Intergenic
1006603006 6:35238234-35238256 ATGAGAGTAGGGAAACAAGGTGG - Intronic
1006750605 6:36374432-36374454 CTGATAGTAGGGCAGGAAAGAGG + Intronic
1006894727 6:37460273-37460295 GTGTGGCTAGTGAAGGAAGGTGG + Intronic
1007027351 6:38589886-38589908 CTTAAGGTAGAGAAGGAAGAAGG - Intronic
1007134460 6:39507901-39507923 AAGAGGGAAAGGAAGGAAGGAGG - Intronic
1007186774 6:39978427-39978449 ATGAAGGTAGGGAGGTAAGGAGG + Intergenic
1007273774 6:40658603-40658625 CAGAGGGGAGGGAAGGACAGGGG - Intergenic
1007298206 6:40844972-40844994 CCTAGGGTACTGAAGGAAGGAGG + Intergenic
1007342761 6:41201996-41202018 CTGGAGGCAGGGGAGGAAGGGGG - Intergenic
1007424469 6:41737731-41737753 CTGAGGATATAGGAGGAAGGTGG + Exonic
1007601271 6:43083193-43083215 CTGAGGTTAGGGAGAGCAGGAGG - Intronic
1007915132 6:45554321-45554343 CTGAAGGGAGGGAAGGAGGAGGG + Intronic
1007959622 6:45947012-45947034 CTCAGGACAGGGAAGGTAGGTGG + Intronic
1008156532 6:48021891-48021913 CTGAAGATAGGGGATGAAGGTGG + Intronic
1008318755 6:50080612-50080634 CAGAGGGTTGGGGTGGAAGGAGG - Intergenic
1008394839 6:50994325-50994347 CTAGGGGTAGGGAAGGAGGAAGG + Intergenic
1008541375 6:52549242-52549264 AGGAGGGAAGGGAGGGAAGGAGG - Intronic
1008558826 6:52703444-52703466 GGGAAGGGAGGGAAGGAAGGAGG - Intergenic
1008702660 6:54119989-54120011 GTGAGAGTAGAGAAGGAAAGGGG - Intronic
1009243110 6:61203266-61203288 AGGAGGGAAGGGAGGGAAGGAGG + Intergenic
1009560828 6:65240427-65240449 GAGAGGGTTGGGAGGGAAGGAGG - Intronic
1009798964 6:68508670-68508692 CAGGGGGAAGGGTAGGAAGGGGG - Intergenic
1010168200 6:72941631-72941653 GTGCGGGTGGGGAAGGGAGGAGG - Intronic
1010676096 6:78745436-78745458 CTGGGGGCAGGGATGGCAGGTGG + Intergenic
1010749038 6:79597372-79597394 GGAAGGGAAGGGAAGGAAGGAGG + Intergenic
1010903256 6:81453898-81453920 CTGAGGATATGTGAGGAAGGAGG - Intergenic
1011603352 6:89080386-89080408 ATGGGGGTGGGGAAGGGAGGGGG - Intergenic
1011855722 6:91688404-91688426 CAGAGAGGAAGGAAGGAAGGAGG - Intergenic
1011950895 6:92962409-92962431 TTGAGGGTAGAGCAGGGAGGAGG + Intergenic
1013059676 6:106620962-106620984 CAGAAGGGAGGGCAGGAAGGGGG - Intronic
1013123275 6:107159310-107159332 CGGAAGGGAGGGAGGGAAGGAGG + Intronic
1013327898 6:109066409-109066431 ATTAGGGTAAGGAAGGAATGTGG + Intronic
1013366601 6:109442091-109442113 CTGGAGGTGGGGAAGGGAGGTGG - Intronic
1013618034 6:111862873-111862895 CTAAGGAAAGGGAAGGACGGGGG + Intronic
1013739111 6:113262718-113262740 GAGAGGGTAGGAAGGGAAGGGGG + Intergenic
1013803270 6:113970751-113970773 CTGAGGGGTGGGAAGGAGGAGGG - Intronic
1014648366 6:124004432-124004454 GGGAGGGTGGGGAAGGAAGAGGG + Intronic
1015007663 6:128303071-128303093 GTGAGTTTAGGGAAGGAAGGCGG - Intronic
1015089003 6:129331384-129331406 CTGAGGGTAAGGATGGGAGGGGG - Intronic
1015674802 6:135733790-135733812 ATGAGGGTAGAGAAGAGAGGAGG - Intergenic
1015849006 6:137552417-137552439 GGGAGGGAAGGGAAGGAAGGGGG - Intergenic
1016053543 6:139554921-139554943 CTGAGGGTAGAGGAGAATGGGGG - Intergenic
1016087751 6:139935791-139935813 CTGAAGGCACTGAAGGAAGGAGG - Intergenic
1016096547 6:140044721-140044743 GGGAAGGGAGGGAAGGAAGGAGG + Intergenic
1016278447 6:142382878-142382900 GTGAGAGTAGGGCAGGCAGGAGG + Intronic
1016402353 6:143694162-143694184 GAGTGGGGAGGGAAGGAAGGAGG + Intronic
1016432316 6:143999108-143999130 CTGAGGGGAGTGAAAGAAGCAGG + Intronic
1016547358 6:145239116-145239138 AGGGAGGTAGGGAAGGAAGGAGG - Intergenic
1016586248 6:145689966-145689988 CTGATGGTCGGGTGGGAAGGAGG - Intronic
1016623507 6:146139954-146139976 CGGAGGGAAGGGAAGGGAAGGGG - Intronic
1016758330 6:147711067-147711089 AGGAAGGAAGGGAAGGAAGGGGG + Intronic
1017318612 6:153062267-153062289 CTGGGGGTAGGGAGGAGAGGTGG - Intronic
1017616323 6:156250413-156250435 CTAGGGAAAGGGAAGGAAGGAGG - Intergenic
1017727799 6:157287674-157287696 CAGAAGGGAGGGAAGGGAGGAGG - Intergenic
1017757620 6:157542838-157542860 CTGAGCGCTGGGAAGGAAGGAGG + Intronic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1018610003 6:165639025-165639047 AGGAAGGGAGGGAAGGAAGGAGG + Intronic
1018906799 6:168080273-168080295 CTGAGCGGAGGGAGGGAGGGAGG - Intronic
1018973715 6:168547406-168547428 CGAAGGGTAGGGTAGGATGGAGG + Intronic
1019416707 7:931012-931034 AGGAGGGTAGGGAGGGACGGAGG + Intronic
1019477276 7:1249945-1249967 CTGGGGGGAGGGACGGAGGGAGG + Intergenic
1019557207 7:1638527-1638549 CTGAGAGGAGGGAGGGAGGGAGG + Intergenic
1019706609 7:2499960-2499982 GAGAGGGTTGGGGAGGAAGGTGG + Intergenic
1019797947 7:3065881-3065903 TGGAGGGGTGGGAAGGAAGGAGG - Intergenic
1019911401 7:4102504-4102526 CTGCGTGTGGGGAAGGGAGGAGG - Intronic
1019937723 7:4267286-4267308 AAGAAGGGAGGGAAGGAAGGAGG - Exonic
1020133785 7:5574683-5574705 CTAAGGGAAGAGAAGGAAGGAGG + Intergenic
1020441522 7:8221890-8221912 GTGGGGGTAGGGACGGAGGGTGG + Intronic
1020877251 7:13713484-13713506 AAGGGGGAAGGGAAGGAAGGGGG + Intergenic
1020877258 7:13713500-13713522 AAGGGGGAAGGGAAGGAAGGGGG + Intergenic
1021417374 7:20403757-20403779 AGGAAGGGAGGGAAGGAAGGAGG + Intronic
1021858549 7:24882243-24882265 GTGAGGGTGGGGGAGGGAGGAGG - Intronic
1021983509 7:26077544-26077566 AGGAAGGAAGGGAAGGAAGGAGG + Intergenic
1022033314 7:26512224-26512246 CTGAAGGTACTGAAGGAAGACGG + Intergenic
1022522842 7:31019144-31019166 GTGTGGGTAGGGCAGGAGGGAGG + Intergenic
1022906839 7:34865979-34866001 ATAAAGGCAGGGAAGGAAGGTGG - Intronic
1023239408 7:38127791-38127813 CTGGATGGAGGGAAGGAAGGAGG - Intergenic
1023460760 7:40393747-40393769 CTGAAGGAAGGGAATGAAGATGG + Intronic
1023522815 7:41065845-41065867 CTGTGGGTGGGGAAGGCGGGAGG + Intergenic
1023533445 7:41183137-41183159 GGGAGGGGAGGGGAGGAAGGGGG - Intergenic
1023565146 7:41516684-41516706 GTGGGAGTAGGGCAGGAAGGTGG - Intergenic
1023820434 7:43977618-43977640 AGGAGGGAAGGGAAGGAAAGGGG - Intergenic
1023820463 7:43977714-43977736 GAGAGGGGAAGGAAGGAAGGAGG - Intergenic
1023968794 7:44977188-44977210 CTGAGAGTGGAGAAGGAAGAAGG + Intronic
1024071732 7:45791998-45792020 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1024229910 7:47355870-47355892 ATGAGGGAGGGGAAGGAAGATGG + Intronic
1024518865 7:50285154-50285176 GGGAGGGGAGGGAGGGAAGGAGG + Intergenic
1024525254 7:50343158-50343180 GGGAGGGTGGGGAGGGAAGGAGG - Intronic
1024577194 7:50774179-50774201 CTTAGGGTTGGGAAAGCAGGGGG + Intronic
1024650769 7:51401433-51401455 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1025054890 7:55757013-55757035 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1025132963 7:56387239-56387261 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1025321606 7:58100272-58100294 ATGAGGGAAGGAAGGGAAGGAGG + Intergenic
1025909515 7:65817104-65817126 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1025911028 7:65828827-65828849 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1026023003 7:66725360-66725382 CTGAGGGTGGGGCAGAATGGAGG - Intronic
1026040744 7:66865910-66865932 GTGAGGGGAGGGAAGGGAGGAGG - Intergenic
1026179785 7:68028789-68028811 CGGAGGGAAGGGAGGGAGGGAGG - Intergenic
1026662829 7:72317186-72317208 AGGAGGGGAGGGAAGGAGGGAGG + Intronic
1026677207 7:72437899-72437921 GAGAGGGAAGGGAAGGAGGGAGG - Intronic
1026840423 7:73667759-73667781 CTGGGGGTGGGGCAGGGAGGAGG - Intergenic
1026887747 7:73964232-73964254 CTGAGGGTGGGGCAGAATGGAGG - Intergenic
1026970217 7:74463119-74463141 CTGAGGGTAGGGAAGGAAGGTGG + Intronic
1027005987 7:74693503-74693525 CTGAGGAAAGGGAATGATGGGGG - Intronic
1027224990 7:76238072-76238094 CTGAGGATGGGGAGGGCAGGGGG - Intronic
1028163081 7:87507978-87508000 ATTAGTGTAGGGAGGGAAGGGGG + Intronic
1028710574 7:93903091-93903113 CTGATGGTAGTGCAGGATGGAGG + Intronic
1028828977 7:95305944-95305966 GGGAGGAGAGGGAAGGAAGGTGG + Intronic
1029137825 7:98387148-98387170 CAGAGGGTAGGGAAGGAGCAAGG + Intronic
1029145015 7:98439649-98439671 CTCAGTGGAGGGAAGGAAGTGGG - Intergenic
1029334106 7:99885860-99885882 CTGGGGGTTGGGAGGGCAGGTGG + Intronic
1029350694 7:100011090-100011112 TGGAAGGGAGGGAAGGAAGGAGG - Intergenic
1029748723 7:102531140-102531162 AGGAGGGAAGGGAAGGAAAGGGG - Intergenic
1029748739 7:102531193-102531215 GAGAGGGGAAGGAAGGAAGGAGG - Intergenic
1029766670 7:102630224-102630246 AGGAGGGAAGGGAAGGAAAGGGG - Intronic
1029766686 7:102630277-102630299 GAGAGGGGAAGGAAGGAAGGAGG - Intronic
1029882409 7:103829336-103829358 CTGGGGGAAGGGAAAGAAGAAGG - Intronic
1030097263 7:105911371-105911393 CTGGGGGAAGGGGAGGAATGAGG + Intronic
1031374020 7:121002628-121002650 ATGAAGATAGGGAAGAAAGGAGG + Intronic
1031384715 7:121134452-121134474 GGGAGGGTAGGAAGGGAAGGAGG + Intronic
1031468569 7:122143663-122143685 CTGGGCGTGGGGAGGGAAGGGGG + Intronic
1031798948 7:126217439-126217461 CTGGGGGAAGGGTGGGAAGGGGG - Intergenic
1032048349 7:128629604-128629626 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1032049950 7:128642427-128642449 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1032242432 7:130174390-130174412 TTGAGGGTAGGGGTGGAGGGTGG + Intronic
1032448485 7:132004831-132004853 CTTAGGGGAGGGAAGGTAGGTGG + Intergenic
1032450276 7:132024674-132024696 AAGAGGGTAGTGAAGGAAGCAGG + Intergenic
1032517623 7:132518833-132518855 CTGGGGGAGGGAAAGGAAGGAGG - Intronic
1033088932 7:138367456-138367478 CGGTGTGTAGGGAAGGGAGGGGG - Intergenic
1033172399 7:139095618-139095640 CTGAGGATAGGGGAGGCCGGAGG + Intronic
1033215632 7:139491409-139491431 CTGAGGGTAGCAAAGGGAGGAGG + Intergenic
1033423187 7:141220516-141220538 CTAGGGGGAGGGAAGGGAGGAGG + Intronic
1033467465 7:141608514-141608536 ATGAGGTTAGAGAAGTAAGGAGG + Intronic
1033478661 7:141716362-141716384 GGGAGGGTAGGGAAGAAGGGAGG - Intronic
1034286360 7:149885579-149885601 CTGAGGTTAGGGAGCCAAGGCGG - Intergenic
1034289037 7:149913387-149913409 CTGAGGATAGGGGAGGCGGGTGG + Intergenic
1034313495 7:150110443-150110465 CTGAGGGTGGGGCTGGAAGAGGG + Intergenic
1034313514 7:150110512-150110534 CTGAGGGTGGGGCTGGAAGAGGG + Intergenic
1034313532 7:150110581-150110603 CTGAGGGTGGGGCTGGAAGAGGG + Intergenic
1034465154 7:151223648-151223670 ATGGGGGTAGGGAAGGAGGGAGG + Intronic
1034662034 7:152779462-152779484 CTGAGGATAGGGGAGGCGGGTGG - Intronic
1034793365 7:153990221-153990243 CTGAGGGTGGGGCTGGAAGAGGG - Intronic
1034819394 7:154202771-154202793 CTCAAGGCATGGAAGGAAGGAGG - Intronic
1034829344 7:154295664-154295686 CTGAGGGTAGGGAGGGGAAGGGG - Intronic
1034868153 7:154658263-154658285 CTGAGGGCAGGGGAAGAAGGAGG + Intronic
1034899208 7:154897142-154897164 CTGAGGCCAGGGAAGGAGGGAGG + Intergenic
1034974128 7:155438102-155438124 CTGAGGCCAGGTGAGGAAGGCGG + Intergenic
1035038085 7:155908372-155908394 CTGAGGGCAGGGAGGAGAGGGGG - Intergenic
1035143316 7:156786198-156786220 GGAAGGGAAGGGAAGGAAGGAGG + Intronic
1035413836 7:158667516-158667538 CACAGGGTAGGTAAGGAGGGCGG - Intronic
1035413866 7:158667602-158667624 CACAGGGTAGGTAAGGAGGGCGG - Intronic
1035413904 7:158667716-158667738 CACAGGGTAGGTAAGGAGGGCGG - Intronic
1035413977 7:158667921-158667943 CAGAGGGTAGGTAAGGAGGGCGG - Intronic
1035414046 7:158668123-158668145 CAGAGGGTAGGTAAGGAGGGCGG - Intronic
1035414066 7:158668179-158668201 CCCAGGGTCGGTAAGGAAGGCGG - Intronic
1035453114 7:158991875-158991897 CTGAGGGAGGGGAGGGAGGGAGG + Intergenic
1036007797 8:4686837-4686859 CTGCAGGGAGAGAAGGAAGGAGG + Intronic
1036581876 8:10082426-10082448 AGGAGGGCTGGGAAGGAAGGTGG - Intronic
1036634250 8:10538235-10538257 CTGAAGATGGGGAAGGAAGGGGG - Intronic
1036672489 8:10801186-10801208 CTGCAGAAAGGGAAGGAAGGGGG + Intronic
1037097982 8:15008619-15008641 CGGATGGGAGGGAAGGAAGGAGG + Intronic
1037804560 8:22051836-22051858 TTGATGGTAGGGAAGGTAAGTGG - Intronic
1037908208 8:22727864-22727886 CTGAGTGGAGGGGAGGAGGGAGG - Intronic
1038038578 8:23705945-23705967 GTGATGGTAGGGAAGGGCGGTGG + Intronic
1038041122 8:23725280-23725302 CTGAGAATAGGGAAGGAGGTGGG - Intergenic
1038046374 8:23768798-23768820 GAGAGGGAAGGGAAGGAGGGAGG - Intergenic
1038156306 8:24993961-24993983 CTGAGGGTGAGGGAAGAAGGAGG + Intergenic
1038158279 8:25011889-25011911 CTGAGGGACGGGAAGGTAGTTGG - Intergenic
1038503952 8:28068175-28068197 AGGAAGGAAGGGAAGGAAGGAGG + Intronic
1038752113 8:30305278-30305300 CTGAGGCCAGGGCAGGATGGAGG - Intergenic
1038922185 8:32097002-32097024 CTGAAGGCAGGGAAGGATGAGGG - Intronic
1039027673 8:33275521-33275543 GTGAGAGAAGGGAAGGGAGGTGG - Intergenic
1039087635 8:33795747-33795769 GAGAGGGTAGTGAAGGAGGGAGG - Intergenic
1039485356 8:37905481-37905503 CAGTGGGAAGGGAAGGAAAGGGG - Intergenic
1039740406 8:40377760-40377782 CTGAGTTTAGGGAAGGGAGATGG + Intergenic
1040562022 8:48531410-48531432 CTGAGTGCAGGGGAGGATGGGGG - Intergenic
1040812830 8:51475769-51475791 GTGAGGGAAGGGAGGGAGGGGGG - Intronic
1040866336 8:52052298-52052320 GGGTGGGGAGGGAAGGAAGGGGG - Intergenic
1040905019 8:52459549-52459571 CTTATTGTAAGGAAGGAAGGAGG + Intronic
1041136631 8:54766002-54766024 AGGAAGGAAGGGAAGGAAGGAGG + Intergenic
1041201663 8:55455395-55455417 CTGAGGGGGAGGAAGGATGGAGG - Intronic
1041573928 8:59371076-59371098 AGGAGGGAAGGGAAGGAAAGAGG - Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1041799976 8:61788090-61788112 CTATGGGTGGGGTAGGAAGGGGG + Intergenic
1045063127 8:98425389-98425411 TTGAGGGTAGGGCAGAATGGAGG + Intronic
1045224830 8:100234421-100234443 CTGAGGGTAGGGGTGGAGGGAGG - Intronic
1046383818 8:113483803-113483825 CAGAGAGTGGGGAAGGAAGTGGG - Intergenic
1046829633 8:118730340-118730362 GTGAGGGTGGGGAAGGGAGATGG - Intergenic
1046886626 8:119374727-119374749 CTGAGGGATGGGAAGGAAGAAGG + Intergenic
1047059522 8:121209052-121209074 GGGAGGGAGGGGAAGGAAGGAGG - Intergenic
1047102536 8:121694127-121694149 GTGAGGGTGCGGAAGGAGGGAGG + Intergenic
1047188985 8:122661019-122661041 CTGAATGTAGGGGAGGAAGGTGG - Intergenic
1047330346 8:123881294-123881316 ATGAGGGTAGGGTAGAATGGTGG + Intronic
1047598794 8:126406003-126406025 AGGAAGGAAGGGAAGGAAGGAGG - Intergenic
1047771582 8:128034200-128034222 CTAAGTGTAGAGAAGGAAAGAGG - Intergenic
1047904040 8:129453793-129453815 CTGAGGATAGGGCAGGATGCTGG - Intergenic
1047953667 8:129956816-129956838 CTGGGGGGAGGGAGGGAGGGAGG - Intronic
1048314112 8:133349572-133349594 GTGAGGGAAGGGAAGGAAGGGGG + Intergenic
1049036279 8:140078785-140078807 CTGGGGGCAGGGAGGGGAGGTGG - Intronic
1049246554 8:141565812-141565834 GTGAGGGTGGGGAAGGAGGGGGG + Intergenic
1049270559 8:141693439-141693461 CTGAGGGATGGGCAGGAAGGAGG + Intergenic
1049311798 8:141937426-141937448 GGGAGGGCAGGGAAGGAAAGAGG - Intergenic
1049471790 8:142777967-142777989 CTGAGCGCAGGGGAGGCAGGCGG - Exonic
1049482749 8:142834727-142834749 TTGAGGGTCCGGAAGGAGGGCGG + Intronic
1049891071 9:71900-71922 GAGAGGGTTGGGAAGGAAGGAGG + Intergenic
1049963858 9:761055-761077 CTGAGGGCAGGAGAGGATGGAGG + Intergenic
1050058825 9:1684031-1684053 CTGGGGCTGGGCAAGGAAGGAGG - Intergenic
1050132208 9:2424633-2424655 CTTATGCTAGGGAAGGGAGGTGG - Intergenic
1050136886 9:2474786-2474808 CTGGGGGTGGGGATGGGAGGTGG + Intergenic
1050255093 9:3785904-3785926 AGGAGGGGAGGGAAGGAAGGAGG - Intergenic
1050302827 9:4276382-4276404 GTGAGGGGAGGGAAGGGAAGGGG + Intronic
1050690803 9:8224290-8224312 CTGAAGGTATGCAAAGAAGGAGG + Intergenic
1050927987 9:11289598-11289620 ATGGAGGGAGGGAAGGAAGGAGG + Intergenic
1051395605 9:16616769-16616791 GGGAGGGGAGGGGAGGAAGGAGG + Intronic
1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG + Intronic
1052231074 9:26153441-26153463 GGGAAGGAAGGGAAGGAAGGGGG + Intergenic
1052503001 9:29316909-29316931 CTTAAGGGAGGGAGGGAAGGGGG + Intergenic
1052926299 9:34019506-34019528 CTGGGGGTAGGGGAAGAATGGGG + Intronic
1053129378 9:35606286-35606308 GTGAGGATAGGCCAGGAAGGAGG + Intronic
1053301232 9:36951098-36951120 TTGGGGGTAGGGAAGTAGGGTGG + Intronic
1053381777 9:37654978-37655000 CCGGGGGCAGGGAAGGAGGGAGG - Intronic
1053677724 9:40453286-40453308 CTTAGGGTAGGGAAAGAGAGTGG - Intergenic
1053732512 9:41072955-41072977 GAGAGGGTTGGGAAGGAAGGAGG + Intergenic
1053927641 9:43081120-43081142 CTTAGGGTAGGGAAAGAGAGTGG - Intergenic
1054286001 9:63171669-63171691 CTTAGGGTAGGGAAAGAGAGTGG + Intergenic
1054290798 9:63288812-63288834 CTTAGGGTAGGGAAAGAGAGTGG - Intergenic
1054388819 9:64593359-64593381 CTTAGGGTAGGGAAAGAGAGTGG - Intergenic
1054506898 9:65923012-65923034 CTTAGGGTAGGGAAAGAGAGTGG + Intergenic
1054695919 9:68358620-68358642 GAGAGGGTTGGGAAGGAAGGAGG - Intronic
1054850583 9:69842978-69843000 GTGGGGGTGGGGAAGGAAAGAGG + Intronic
1054992289 9:71343088-71343110 CTTAGAGTAGGGAAGGGAGGGGG + Intronic
1055505818 9:76948051-76948073 CAGAGGCTGGGGAAGGAGGGTGG - Intergenic
1055514419 9:77021251-77021273 ATGGGGGGAGGGAACGAAGGAGG + Intergenic
1055760458 9:79601679-79601701 CTGAGGAGAGGGAAAGAAGGGGG - Intronic
1055767624 9:79681732-79681754 CTGGAGGCAGGGAGGGAAGGAGG + Intronic
1056040252 9:82658489-82658511 CTGAGAGAAAAGAAGGAAGGTGG + Intergenic
1056075258 9:83031854-83031876 ATGGGGGCAGGGATGGAAGGTGG - Intronic
1056844194 9:90023444-90023466 CAGAGGTGAGGGAAGAAAGGAGG + Intergenic
1057063802 9:92029276-92029298 CTGACTGTGGGAAAGGAAGGAGG - Intergenic
1057099390 9:92343700-92343722 CTGAGGGAAGCCAAGGCAGGAGG + Intronic
1057169179 9:92950621-92950643 CTGATGGTGGGGAAAGAAGGGGG + Intronic
1057191371 9:93089754-93089776 CTGGGGGCAGGGAAGGAGGGAGG - Intergenic
1057267602 9:93629639-93629661 CAGGGGGCAGGGAAGGAAGAGGG - Intronic
1058261803 9:102842629-102842651 CTGAGTGTTGGAAAGGTAGGTGG + Intergenic
1058833169 9:108837507-108837529 CTGAGGGTAGAGAGGGAGGCTGG - Intergenic
1058835035 9:108853187-108853209 GTGAGGGTAGGGAAGGGGGCAGG + Intergenic
1059562864 9:115352032-115352054 AAGAAGGGAGGGAAGGAAGGAGG + Intronic
1059915320 9:119093289-119093311 CTGTGGGGATGGAAGGATGGAGG + Intergenic
1060031597 9:120219035-120219057 CTGATGAGAGGGAAGGAAGCAGG + Intergenic
1060408128 9:123382626-123382648 CTGTTGGGAGGGAAGGAGGGCGG + Intronic
1060554642 9:124501948-124501970 TTGAGGGTAGGGAGGCAAAGAGG + Intronic
1060927802 9:127467439-127467461 CTTAAGGGAGGGAGGGAAGGGGG + Intronic
1060990322 9:127845271-127845293 CTGTGGGAAGGTGAGGAAGGAGG - Intronic
1061022175 9:128023058-128023080 CAGAGGGTAGAGGAGGAAGTGGG - Intergenic
1061138820 9:128752146-128752168 CTGAGGATCAGGAAGGAAGGAGG - Intronic
1061255825 9:129453830-129453852 ATCAGGGTATGGAAGGATGGGGG + Intergenic
1061339207 9:129965767-129965789 GGGAGGGAAGGGAGGGAAGGAGG + Intronic
1061632422 9:131881430-131881452 AGGAAGGGAGGGAAGGAAGGAGG + Intronic
1061945842 9:133907926-133907948 GGGAGGGTGGTGAAGGAAGGGGG - Intronic
1061950128 9:133931475-133931497 CAGAAGGGAGGGAAGAAAGGAGG - Intronic
1062010837 9:134265821-134265843 ATGAAGGTAGGGAGGGAAGGAGG - Intergenic
1062144068 9:134979123-134979145 GAGGGGGGAGGGAAGGAAGGAGG + Intergenic
1062398076 9:136360544-136360566 CTGCGGGGAGGGAAGGGCGGAGG + Intronic
1062437589 9:136553442-136553464 CTCAGTGTAGGGGGGGAAGGGGG + Intergenic
1062751957 9:138261861-138261883 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1062753559 9:138274642-138274664 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1203576071 Un_KI270745v1:9421-9443 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1185492503 X:528656-528678 GGGAGGGAAGGGAAGGAAGAGGG - Intergenic
1185578538 X:1192795-1192817 AGGAAGGAAGGGAAGGAAGGAGG - Intronic
1185680008 X:1880799-1880821 GAGGGGGTAGGGAGGGAAGGAGG + Intergenic
1186053624 X:5626563-5626585 AGGAAGGGAGGGAAGGAAGGAGG + Intergenic
1186137305 X:6533575-6533597 CTGATGGTGGGGAGGGAGGGAGG - Intergenic
1186267139 X:7844164-7844186 CTGATGGTGGGGAGGGAGGGAGG + Intergenic
1186298006 X:8169901-8169923 CTGATGGTGGGGAGGGAGGGAGG - Intergenic
1186319947 X:8413445-8413467 CTGAGGGTAGGCTAGGGATGTGG - Intergenic
1186324844 X:8466531-8466553 CTGATGGTGGGGAGGGAGGGAGG + Intergenic
1186534797 X:10335483-10335505 CAGAGGTTAGGAAAGGAAGAGGG + Intergenic
1186672348 X:11780550-11780572 CAGAGGGGAAGGAAGGAAGGAGG - Intergenic
1186985678 X:15011253-15011275 GTGAGGGAAGGGAAGGAATCAGG + Intergenic
1187357597 X:18591778-18591800 CTGAGTCTAGGGGAGGAAGGAGG - Intronic
1187715888 X:22102201-22102223 CAGAGGGGAAGGAGGGAAGGAGG - Intronic
1187911237 X:24113043-24113065 TGGAAGGGAGGGAAGGAAGGAGG - Intergenic
1188201116 X:27293672-27293694 CAGACGGCAGGGAAAGAAGGAGG + Intergenic
1188612353 X:32116099-32116121 GAGAAGGTGGGGAAGGAAGGAGG - Intronic
1189320000 X:40082216-40082238 TTGGGGGTGGGGAAGGAAAGGGG - Intronic
1189593353 X:42538836-42538858 CAGAGTGTAGGGAAGAAATGGGG - Intergenic
1190740946 X:53288393-53288415 CTGTTGCTAGGGAAGGAGGGAGG - Intronic
1191904886 X:66077211-66077233 AGGAGGGAAGGGAAGGAGGGAGG - Intergenic
1192034035 X:67544664-67544686 CTCGGGGTGGGGAAGGCAGGAGG - Exonic
1192229372 X:69254617-69254639 CTGGGGGTGGGGAAGGGAGAAGG + Intergenic
1192261357 X:69507328-69507350 CAGAGGGTTGGGAAGGAAAAGGG + Intronic
1193456699 X:81740134-81740156 CTGGGGGAAAGGAAGGAAGGAGG - Intergenic
1194675820 X:96792439-96792461 CTGCTGGCAGGGAAGGATGGAGG - Intronic
1195299045 X:103509388-103509410 GAGAGGGGAGGGAAGGAAAGGGG - Intronic
1195299055 X:103509413-103509435 GAGAGGGGAGGGAAGGAAAGGGG - Intronic
1195299078 X:103509479-103509501 GAGAGGGGAGGGAAGGAAAGGGG - Intronic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1195355287 X:104033700-104033722 CTGAGGAAGGGGCAGGAAGGAGG + Intergenic
1195378948 X:104253709-104253731 ATGAGGCTAGCGAAGGAAAGGGG + Intronic
1196136657 X:112217136-112217158 CTGATTGGAGGGAAGGAAGCTGG + Intergenic
1196322523 X:114358498-114358520 CTGATGGTAGGAATGTAAGGGGG + Intergenic
1196619359 X:117804923-117804945 GGGAGGGAGGGGAAGGAAGGAGG + Intergenic
1196767691 X:119263438-119263460 ATGAGGGTAGGGAGGAAATGTGG - Intergenic
1196976708 X:121166167-121166189 CTGAGGATAGGGTGGGGAGGAGG - Intergenic
1197032435 X:121833588-121833610 GTGAGGGTTGGGAGGGAAGTGGG + Intergenic
1197198992 X:123732750-123732772 GGGAGGCCAGGGAAGGAAGGAGG + Intronic
1197586633 X:128355943-128355965 CTGAGTCTAGGGAAGGTAGGAGG - Intergenic
1197713470 X:129688862-129688884 CTGAGGGAAGAGCAGGAAGTAGG - Intergenic
1197977923 X:132185002-132185024 CTGAGGGCAGGGATGGAGTGTGG - Intergenic
1198928695 X:141828050-141828072 CTAAGGGTAGAGAATGAAGAAGG - Intergenic
1199111412 X:143939774-143939796 CAGAGGGTAGGGGTGGGAGGAGG + Intergenic
1199707193 X:150438507-150438529 CTGAGGGGAGGGGAAGAATGAGG - Intronic
1199864111 X:151827636-151827658 CTGTGGGCCTGGAAGGAAGGAGG - Intergenic
1200103672 X:153700911-153700933 CTGCAGGCAGGGGAGGAAGGAGG + Exonic
1200253107 X:154564278-154564300 CAGAGGGAAGGGGAGGATGGAGG - Intronic
1200264660 X:154640137-154640159 CAGAGGGAAGGGGAGGATGGAGG + Intergenic
1201458910 Y:14201242-14201264 AGGAAGGAAGGGAAGGAAGGAGG + Intergenic
1201480430 Y:14432742-14432764 GGGAGGGGAAGGAAGGAAGGAGG + Intergenic
1201528326 Y:14961527-14961549 CAGAGGCTAGGAAAGGTAGGCGG + Intergenic
1201550361 Y:15211713-15211735 GAGAGGGGAAGGAAGGAAGGAGG + Intergenic
1201558696 Y:15292080-15292102 AAGAAGGAAGGGAAGGAAGGAGG + Intergenic
1201578236 Y:15483587-15483609 GGGAGGGAAGGGAGGGAAGGAGG - Intergenic