ID: 1026972338

View in Genome Browser
Species Human (GRCh38)
Location 7:74476050-74476072
Sequence GAGAAGAGGCTGTTTTGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 161}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026972338_1026972353 30 Left 1026972338 7:74476050-74476072 CCTGTACAAAACAGCCTCTTCTC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1026972353 7:74476103-74476125 GTGGCTATTTTGCAGTTGGATGG No data
1026972338_1026972345 -1 Left 1026972338 7:74476050-74476072 CCTGTACAAAACAGCCTCTTCTC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1026972345 7:74476072-74476094 CCAATGCCTGGTGGTGGTGAGGG No data
1026972338_1026972350 6 Left 1026972338 7:74476050-74476072 CCTGTACAAAACAGCCTCTTCTC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1026972350 7:74476079-74476101 CTGGTGGTGGTGAGGGATGGGGG 0: 1
1: 1
2: 8
3: 165
4: 1265
1026972338_1026972343 -2 Left 1026972338 7:74476050-74476072 CCTGTACAAAACAGCCTCTTCTC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1026972343 7:74476071-74476093 TCCAATGCCTGGTGGTGGTGAGG No data
1026972338_1026972347 4 Left 1026972338 7:74476050-74476072 CCTGTACAAAACAGCCTCTTCTC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1026972347 7:74476077-74476099 GCCTGGTGGTGGTGAGGGATGGG No data
1026972338_1026972349 5 Left 1026972338 7:74476050-74476072 CCTGTACAAAACAGCCTCTTCTC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1026972349 7:74476078-74476100 CCTGGTGGTGGTGAGGGATGGGG 0: 1
1: 0
2: 9
3: 125
4: 934
1026972338_1026972352 26 Left 1026972338 7:74476050-74476072 CCTGTACAAAACAGCCTCTTCTC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1026972352 7:74476099-74476121 GGGTGTGGCTATTTTGCAGTTGG 0: 1
1: 0
2: 0
3: 13
4: 105
1026972338_1026972342 -7 Left 1026972338 7:74476050-74476072 CCTGTACAAAACAGCCTCTTCTC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1026972342 7:74476066-74476088 TCTTCTCCAATGCCTGGTGGTGG 0: 1
1: 0
2: 2
3: 32
4: 182
1026972338_1026972340 -10 Left 1026972338 7:74476050-74476072 CCTGTACAAAACAGCCTCTTCTC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1026972340 7:74476063-74476085 GCCTCTTCTCCAATGCCTGGTGG 0: 1
1: 0
2: 1
3: 21
4: 189
1026972338_1026972351 11 Left 1026972338 7:74476050-74476072 CCTGTACAAAACAGCCTCTTCTC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1026972351 7:74476084-74476106 GGTGGTGAGGGATGGGGGTGTGG No data
1026972338_1026972346 3 Left 1026972338 7:74476050-74476072 CCTGTACAAAACAGCCTCTTCTC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1026972346 7:74476076-74476098 TGCCTGGTGGTGGTGAGGGATGG 0: 1
1: 0
2: 4
3: 95
4: 827

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026972338 Original CRISPR GAGAAGAGGCTGTTTTGTAC AGG (reversed) Intronic
900849294 1:5129780-5129802 GGGAAGATGCTGTTTTGAATAGG + Intergenic
901519963 1:9775954-9775976 GAGAGGAGGCAGCTTTGTTCTGG - Intronic
903966680 1:27095016-27095038 CAGAAGAGGCTGCATTGCACAGG + Intergenic
905851533 1:41278465-41278487 GAGAAGGGGCAGTTTTGTTGGGG + Intergenic
905996353 1:42384280-42384302 GAAGGGAGGCTGTTTTCTACAGG - Intronic
907856517 1:58308787-58308809 TAAAGGAGGCTGTTTTTTACCGG - Intronic
910276027 1:85449817-85449839 GAGAAGAGGTGTGTTTGTACTGG + Intronic
913272505 1:117108215-117108237 GGGAAGTTGCTATTTTGTACAGG + Intergenic
913277057 1:117148682-117148704 GGGAAGAGGCTGTTATTTATTGG - Intronic
914876143 1:151513763-151513785 GAGAAGTGGCTGTCTGGTACAGG + Intronic
918869141 1:189944894-189944916 GAAAAGTGACTGTTTTGTAAGGG + Intergenic
919871596 1:201826043-201826065 GAGATGAGGCTGTTTAGAACTGG + Exonic
921913757 1:220582405-220582427 GCAAAGATGCTGTTTTTTACTGG + Intronic
922030627 1:221794138-221794160 GAAAAGAGGCTGCTTTCTATTGG + Intergenic
923096776 1:230781252-230781274 GAAAAGTTGCTGTTTTCTACTGG + Intronic
923167791 1:231383547-231383569 TAGAAGATTCTGTTCTGTACAGG + Intronic
923233809 1:232013087-232013109 GTGAAGTGGCTCTTTTGTACGGG + Intronic
924718150 1:246597914-246597936 TAGAAGAAGCTGTTTTATGCTGG - Intronic
1062808686 10:445321-445343 GTGAAGAGTCTGTCTTGCACTGG + Intronic
1062808722 10:445877-445899 GAGAAGAGTCTATCTTGCACTGG + Intronic
1066032472 10:31442752-31442774 GAGAAGAGATTGTTTTGAAAAGG + Intronic
1068802196 10:61154062-61154084 GAGGAGAGTCTGTTTGGTGCGGG + Intergenic
1069006366 10:63321880-63321902 GAAGAAAGGCTGTTTTGAACTGG - Intronic
1069687900 10:70330875-70330897 GCTAAGAGGCTGTTTTTAACTGG - Intronic
1071816168 10:89234372-89234394 CAGAAGAGACTTTTTTGTTCTGG - Intronic
1072698375 10:97621269-97621291 AAGCAGAGGCTGTGCTGTACAGG - Intronic
1075070804 10:119318868-119318890 GAGAAGAGGCTGTCTTGGTGGGG - Intronic
1075633195 10:124013721-124013743 GGGATGAGGCTGTTTTTTTCTGG - Intronic
1076766357 10:132636417-132636439 GTGACGTGGCTGTTTTGCACAGG - Intronic
1076821223 10:132940737-132940759 GTGAAGAGTCTGTTTTCTGCCGG - Intronic
1079519183 11:21304542-21304564 CAAAAGAAGCTGATTTGTACAGG - Intronic
1080185886 11:29485429-29485451 GAGATGAGGATATTTTGTAAAGG - Intergenic
1081031813 11:38093933-38093955 GAGAAGAGGCTGTATGGAAATGG + Intergenic
1086186392 11:84022040-84022062 AAGAAGCGGTTGTTTTGTCCAGG - Intronic
1086479071 11:87214313-87214335 GAAAAAAGGCTGCTTTGCACTGG - Intronic
1089236246 11:117028803-117028825 GAGAACAGGCTTTATTTTACAGG + Intronic
1089737163 11:120557388-120557410 GAGAAGAGGCTGCGGTGGACAGG - Intronic
1090184521 11:124727948-124727970 AAGAAAAGGGTGTTTTGGACTGG - Intergenic
1090602379 11:128386534-128386556 GTGAAGAGGCTGGTTTGCACAGG - Intergenic
1091723515 12:2830136-2830158 GAGGAAAGGCTGTTTCCTACTGG + Intronic
1098111123 12:67122949-67122971 GAGAAGAGGGTGGTTGGTAAAGG + Intergenic
1102242457 12:111333522-111333544 GAGTAGAGGCTGTTATTTCCTGG + Intronic
1102849711 12:116229070-116229092 TAGAAGAGGCTGTTGTGGCCTGG - Intronic
1106158569 13:27180116-27180138 GATAAGAGGCAGTTTGGTACAGG + Intergenic
1109842530 13:67938142-67938164 GAGAAAGGGCTGTTTTGTTTTGG - Intergenic
1111685831 13:91499752-91499774 GAGATGAGGCTGTTTGAGACTGG - Intronic
1111880563 13:93951166-93951188 GATAAGAGGCTGTTTAGGAGTGG - Intronic
1112263114 13:97896196-97896218 GAGAAGTGGGTGTTTTGTGAGGG + Intergenic
1112725852 13:102303259-102303281 GAGCAGATGCTGTTTTGTGTAGG - Intronic
1114466787 14:22928936-22928958 GAGAAGAGGCTAATTTTGACGGG - Intronic
1115035984 14:28857391-28857413 GAGAAGAGGCTGCGATGTACTGG + Intergenic
1121486636 14:94321469-94321491 GAGAAAAGGCTGATGTGTGCTGG - Intronic
1122227084 14:100286174-100286196 GAGCAGAGGCTGCTGAGTACAGG - Intergenic
1127844305 15:62856419-62856441 GAGAAGAAGCTGGGTTGGACAGG + Intergenic
1128549064 15:68585989-68586011 GAGAAAAGGCTGCTTCGTAAGGG - Intronic
1131757966 15:95586493-95586515 GAGAAACAGCTGTTTTCTACTGG + Intergenic
1133261105 16:4550805-4550827 GAGAAGAAGCTGTTATATTCAGG + Intergenic
1134306584 16:13038392-13038414 GAGAAGAGGCTAGATTGTGCAGG - Intronic
1134431381 16:14210949-14210971 GAGGAGTGGCTGTTTTGTATAGG + Intronic
1135050606 16:19189722-19189744 GAGAGGAGGCAGTTGTGTAATGG + Intronic
1136228760 16:28875258-28875280 GAGCAGAGCCTGTGTTTTACGGG - Intergenic
1137031293 16:35526754-35526776 GAGACGAGGCTGTTTTAAATTGG + Intergenic
1138015899 16:53428456-53428478 GAGAAGTGGCTGTTTGGTTCTGG - Intergenic
1140192647 16:72831063-72831085 GGGTAGAGGCTGTTTTCTAGAGG - Intronic
1141590005 16:85062066-85062088 GAGAAGTGGCTTCTTTGGACGGG - Intronic
1142372123 16:89688494-89688516 GAGAAGCAGTTGTTTTGCACAGG + Intronic
1144622435 17:16826080-16826102 GAGAATAGGCTGTTTCGTTGGGG - Intergenic
1146479707 17:33195209-33195231 GTGCAGAGGCTGCTTTGTGCTGG - Intronic
1149046935 17:52256803-52256825 GAGAAGAGGGGAATTTGTACGGG + Intergenic
1154197911 18:12279639-12279661 GCGAAGAGGCTGCTCTGTCCCGG - Intergenic
1155959731 18:31983939-31983961 AAGAAGAGAATGTTTTGCACAGG + Intergenic
1156249243 18:35335604-35335626 GAGAGGAGGCTTTTTTATAATGG - Exonic
1157605218 18:48922182-48922204 GAGAAGAGGCTTTGTTGGCCAGG - Intronic
1158109000 18:53919069-53919091 TAGAAGAGGCTGTCCTGTGCTGG + Intergenic
1158302439 18:56066596-56066618 GGAAAGAGGCTGTTTTCTAAAGG + Intergenic
1158907659 18:62029566-62029588 GGGAAGAGGGTATTTAGTACCGG + Intergenic
1159052722 18:63436580-63436602 GAGAAGAGACTGTTTTGGGCTGG + Intergenic
1159405860 18:68001895-68001917 GAGAAAAGACTGCTTTGGACAGG + Intergenic
1164136565 19:22422140-22422162 GAGAAGGGGCTGGTTGGAACCGG - Intronic
1165217715 19:34288439-34288461 CAGGGGAGGCTGTTTTGTAATGG - Intronic
927318790 2:21718528-21718550 GAGAAGAAGATAATTTGTACAGG - Intergenic
927908064 2:26876208-26876230 GAGAAGATGCTGCCTTGTCCAGG + Intronic
929293851 2:40224217-40224239 GAGATGAGGCTGTCTAGTATGGG + Intronic
929586035 2:43115048-43115070 GAGAAGAGGCTGGATGGCACAGG - Intergenic
931098823 2:58972684-58972706 GAGAAGGGGCAGTTTTTCACTGG + Intergenic
933705180 2:85284308-85284330 CCGAAGAGGCTCTTCTGTACAGG + Intronic
934870394 2:97859983-97860005 GACAAGAGGCAGTTCAGTACTGG - Intronic
934977738 2:98816655-98816677 GAGGAGAGGTCGCTTTGTACTGG + Intronic
935293340 2:101627870-101627892 GAACAGAGGCTGAGTTGTACAGG - Intergenic
936267974 2:111024767-111024789 GAGAACAGGCAGTTGTCTACCGG - Intronic
936269705 2:111040527-111040549 GAGCAGGGGCTGTTTCATACTGG - Intronic
936622166 2:114111767-114111789 GAGAGTTGGCTGTTTGGTACTGG + Intergenic
940102774 2:150060892-150060914 GAGCAGAGGCTGTTTGGTCAAGG + Intergenic
941563261 2:167076017-167076039 CAGAATAGGCAGTTTTTTACAGG + Intronic
945072556 2:206005922-206005944 GAGAAAAGGCTGTGTAGAACAGG + Intronic
945620723 2:212133308-212133330 CAGAAAAGGCTGTTTTGAAAAGG - Intronic
946840244 2:223812589-223812611 GAGAAGTGGCTTTTTTGTTTTGG + Intronic
946892072 2:224287177-224287199 GAGAAGAGCCTGTTTTTGAAAGG + Intergenic
948345681 2:237295974-237295996 GAGCACAGGCTGTTTTCTTCTGG - Intergenic
1169257796 20:4111890-4111912 TAGAAGAGGCTGTTTCTTGCTGG + Intergenic
1174606339 20:51764637-51764659 GAGAGGAGGCAGTTTTGAACCGG - Intronic
1175462576 20:59163591-59163613 GAGATGAGGTTGTTCTGTGCAGG - Intergenic
1175537842 20:59727522-59727544 GAGAAGTGGCTGTGTTGGGCAGG + Intronic
1180725812 22:17945804-17945826 GAGAAGAGGCTGTATTTAGCAGG + Intronic
1181418042 22:22774267-22774289 TAGAAGAGGCTGTTTTCAAAAGG + Intronic
1184231668 22:43161473-43161495 AAGAAGAAGCTGTTATGTAGAGG - Intronic
950925928 3:16742038-16742060 GAGAAGAGACTGTCTTGGATGGG - Intergenic
951146000 3:19228026-19228048 GAGAGGAGGCTAATTTGTTCAGG + Intronic
951513755 3:23534220-23534242 GAGAACAGGCTGTCATATACAGG - Intronic
952753690 3:36847238-36847260 GAGAAGAGCCTGGTTTGTCCAGG + Exonic
956501427 3:69890203-69890225 TATAAGAGGCTGTTTTTGACAGG - Intronic
956781597 3:72607339-72607361 GAGAAGAGGCTGTAGTGGAACGG - Intergenic
960330314 3:116351582-116351604 GGGAAGAGTCTGTTTAGTCCAGG - Intronic
964911499 3:161787915-161787937 GAGAAAAAGGTTTTTTGTACTGG - Intergenic
965211713 3:165798123-165798145 GATAAAAGGCTGTTTGGTAAAGG + Intronic
966092606 3:176158596-176158618 GAGAAGAGTCTGTCCTGTGCAGG + Intergenic
967706387 3:192655926-192655948 GAAAAGAAGCTGTTTGGGACTGG + Intronic
967765162 3:193271248-193271270 GAGGAGAGGCTGTTTGCTCCAGG + Intronic
970211553 4:13715367-13715389 GACTAAAGGCTGTTTTGGACAGG + Intergenic
972890340 4:43550141-43550163 GACAAGAGAATGTATTGTACTGG - Intergenic
975376728 4:73654738-73654760 CAGAGGAGGCTGTTTTGTTGTGG + Intergenic
977556732 4:98494745-98494767 GAGAAGAAACTGTTTTGCTCTGG + Intronic
978093162 4:104742563-104742585 GAGGAGATGCTGTTTTGTATTGG + Intergenic
979970924 4:127134339-127134361 GAAAATAGGCTTTTTTGTAGAGG - Intergenic
981619318 4:146676228-146676250 GGGATGAGGGTGTTTTCTACAGG - Intergenic
984175673 4:176413634-176413656 GAGAGGATGCTGTTTTATATTGG - Intergenic
986357673 5:6944500-6944522 GAGTAGAGGCTGTTTTTCATAGG + Intergenic
987080770 5:14423513-14423535 GCAAAGAGGATGTTTTGAACTGG - Intronic
987566566 5:19595889-19595911 AAGAAGAGGGTGTTTTACACAGG - Intronic
991645599 5:68797491-68797513 GAGAGTAGGCTGTTTTCTTCTGG + Intergenic
1000484325 5:161821195-161821217 GAGAAGAGATTATTTTGCACAGG + Intergenic
1003526297 6:6900571-6900593 GAGAACAGGATGTTTTGTCAAGG + Intergenic
1005829156 6:29656924-29656946 GAGCAGAGGCTGCCTGGTACAGG - Intergenic
1007198906 6:40088589-40088611 GAGAAAAGGGAGTTTTGTAGAGG - Intergenic
1010363729 6:75025530-75025552 GGGAAGAGACAGTTTTGGACTGG - Intergenic
1012093675 6:94931863-94931885 GCAAAGAGGCTGTGTTGCACTGG + Intergenic
1016016033 6:139187134-139187156 GAGAAGAGGGTATTTTTTTCTGG - Intergenic
1018223317 6:161603936-161603958 TAGAAGGGGCTGTTTTATACGGG - Intronic
1018790146 6:167142022-167142044 GAGAAGAGGCCCCTGTGTACAGG - Intergenic
1019354172 7:570308-570330 CAGAAGAGGCTGTGGTGTCCAGG + Intronic
1021220017 7:17964735-17964757 GATTAGAGACTGTTTTGTACAGG - Intergenic
1021360453 7:19706525-19706547 GAAAAGAGTCTGTCATGTACAGG + Intronic
1021438612 7:20651490-20651512 GTCAAGAGCCTGTTTTGTTCGGG + Exonic
1026972338 7:74476050-74476072 GAGAAGAGGCTGTTTTGTACAGG - Intronic
1028275590 7:88852855-88852877 GAGAAGAGGCAGTTTGGTATTGG - Intronic
1028810225 7:95077949-95077971 TAGAAGATACTGTTTTGTAAGGG - Intronic
1031133516 7:117860975-117860997 GAGACGAAACTGTTTAGTACGGG - Intronic
1032336030 7:131025600-131025622 GGGAAGTGGCTGTTTTCTACTGG - Intergenic
1034476546 7:151287672-151287694 GTGAAGAGGATGGGTTGTACAGG + Intergenic
1035154805 7:156903761-156903783 GAGAAGAGGATGTTTTCTTTTGG + Intergenic
1036492104 8:9237264-9237286 TAAAAGAGGCTGTTGTGTCCTGG + Intergenic
1036501778 8:9320718-9320740 GAGTAGATGCTGTTTTGCCCAGG - Intergenic
1037015641 8:13902889-13902911 GATAAGAGGCAGTGTTGTATTGG - Intergenic
1040103948 8:43529013-43529035 GAGAACAGGCTGTTTGACACAGG - Intergenic
1042670534 8:71258140-71258162 CAGAGGAGGCTGTTTGGTAGGGG - Intronic
1043403684 8:79908947-79908969 GAGAAGAGGCTGTAAGGTGCAGG - Intergenic
1044070682 8:87756214-87756236 TGGAAGAGGCTGCTTTGTATAGG - Intergenic
1044496203 8:92886888-92886910 GTTAAGAAACTGTTTTGTACTGG + Intronic
1044751457 8:95420444-95420466 AAGAAGAGGCTGTTTTCCATTGG - Intergenic
1050897388 9:10900381-10900403 GAGAACAGACTGATTGGTACTGG - Intergenic
1054703101 9:68433953-68433975 GTGAATAGGATGTTTTATACAGG - Intronic
1054974037 9:71121573-71121595 GACCACAGGCTGTTTTGTGCAGG - Exonic
1059604580 9:115820380-115820402 GAGAAGAGGATGTGTTTTAAAGG - Intergenic
1060913208 9:127367272-127367294 GAAAAGGGGCTTTATTGTACAGG - Intronic
1061428959 9:130519145-130519167 GAGAGGAGGCTGTCTCGGACTGG - Intergenic
1188676153 X:32942072-32942094 GAGAATAGGATGGTTTGTAAAGG - Intronic
1189456206 X:41192877-41192899 GAAAAGGGGCTGTGTAGTACGGG + Intronic
1192267457 X:69548637-69548659 GAGAAGGAGCTGGTTTGTAGAGG + Intergenic
1193479859 X:82013895-82013917 CAGAAGGGGCTCTATTGTACAGG - Intergenic
1197777901 X:130131809-130131831 GAGAAGAGGGTGTTCTGTCAAGG + Intronic
1198663600 X:138997253-138997275 GAGAAGAGGCGGTCTTGTTTTGG - Intronic
1200704095 Y:6426747-6426769 GAGAACAAGCTGCTTTGTGCAGG + Intergenic
1200922091 Y:8622398-8622420 GAGAATAAGCTGATTTGTGCTGG - Intergenic
1200926087 Y:8656155-8656177 GAGAAGAAGCTGCCTTGTGCTGG - Intergenic
1200960720 Y:8993534-8993556 GAGAAAAAGCTGTCTTGTGCTGG - Intergenic
1201030016 Y:9737961-9737983 GAGAACAAGCTGCTTTGTGCAGG - Intergenic
1202125366 Y:21564819-21564841 GAGAATGGGCTGCTTTGTGCTGG - Intergenic
1202153642 Y:21864573-21864595 GAGAATGGGCTGCTTTGTGCTGG + Intergenic