ID: 1026972341

View in Genome Browser
Species Human (GRCh38)
Location 7:74476064-74476086
Sequence ACCACCAGGCATTGGAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 186}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026972341_1026972347 -10 Left 1026972341 7:74476064-74476086 CCTCTTCTCCAATGCCTGGTGGT 0: 1
1: 0
2: 0
3: 15
4: 186
Right 1026972347 7:74476077-74476099 GCCTGGTGGTGGTGAGGGATGGG No data
1026972341_1026972351 -3 Left 1026972341 7:74476064-74476086 CCTCTTCTCCAATGCCTGGTGGT 0: 1
1: 0
2: 0
3: 15
4: 186
Right 1026972351 7:74476084-74476106 GGTGGTGAGGGATGGGGGTGTGG No data
1026972341_1026972353 16 Left 1026972341 7:74476064-74476086 CCTCTTCTCCAATGCCTGGTGGT 0: 1
1: 0
2: 0
3: 15
4: 186
Right 1026972353 7:74476103-74476125 GTGGCTATTTTGCAGTTGGATGG No data
1026972341_1026972352 12 Left 1026972341 7:74476064-74476086 CCTCTTCTCCAATGCCTGGTGGT 0: 1
1: 0
2: 0
3: 15
4: 186
Right 1026972352 7:74476099-74476121 GGGTGTGGCTATTTTGCAGTTGG 0: 1
1: 0
2: 0
3: 13
4: 105
1026972341_1026972350 -8 Left 1026972341 7:74476064-74476086 CCTCTTCTCCAATGCCTGGTGGT 0: 1
1: 0
2: 0
3: 15
4: 186
Right 1026972350 7:74476079-74476101 CTGGTGGTGGTGAGGGATGGGGG 0: 1
1: 1
2: 8
3: 165
4: 1265
1026972341_1026972354 21 Left 1026972341 7:74476064-74476086 CCTCTTCTCCAATGCCTGGTGGT 0: 1
1: 0
2: 0
3: 15
4: 186
Right 1026972354 7:74476108-74476130 TATTTTGCAGTTGGATGGTGTGG 0: 1
1: 0
2: 0
3: 26
4: 236
1026972341_1026972349 -9 Left 1026972341 7:74476064-74476086 CCTCTTCTCCAATGCCTGGTGGT 0: 1
1: 0
2: 0
3: 15
4: 186
Right 1026972349 7:74476078-74476100 CCTGGTGGTGGTGAGGGATGGGG 0: 1
1: 0
2: 9
3: 125
4: 934

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026972341 Original CRISPR ACCACCAGGCATTGGAGAAG AGG (reversed) Intronic
900389774 1:2428884-2428906 ACCACCAGGCTTGGGTGAGGAGG + Intronic
900997743 1:6131563-6131585 AGAACCAGGCCTGGGAGAAGAGG + Intronic
901677059 1:10891618-10891640 ACTCCCAAGCCTTGGAGAAGGGG - Intergenic
902790236 1:18762770-18762792 ACCACCAGGAATTCCAGATGAGG + Intergenic
903642254 1:24868017-24868039 ACCACCAGGCAATGGTAAGGAGG - Intergenic
904600403 1:31669692-31669714 ATCACCAGGCCTGGGAGGAGAGG + Intronic
906145781 1:43559253-43559275 ACCATCAGGCAGTGGGGAAGGGG + Intronic
906933450 1:50191319-50191341 AGCCCCAGGCATTGGAAAATGGG + Intronic
907038549 1:51237129-51237151 ACCACCAGACACTGGCCAAGGGG - Intronic
907512227 1:54970255-54970277 ATTTGCAGGCATTGGAGAAGAGG + Intergenic
907873722 1:58466127-58466149 ACCCCCAGCCAATGGAGGAGCGG + Intronic
908143714 1:61214974-61214996 ACTACCTGGCATTAGGGAAGTGG - Intronic
910664348 1:89708263-89708285 ACCTCAAGGCTTTGTAGAAGGGG + Intronic
917124451 1:171673744-171673766 ACCAGCAGGCATTGCAACAGGGG + Intergenic
918529395 1:185501606-185501628 ACAACTATGCATTGGAGAAATGG - Intergenic
918699965 1:187596586-187596608 ACTTCCAGTCATGGGAGAAGGGG + Intergenic
918854207 1:189729739-189729761 ACCACCTGGAATTGGGGGAGGGG + Intergenic
919651627 1:200155140-200155162 ACCACCAACCAATGCAGAAGTGG + Intronic
920176313 1:204104149-204104171 ACTCCCAAGCATGGGAGAAGAGG - Intronic
920234242 1:204492533-204492555 AGCACCAGGCACAGGAGGAGTGG + Intronic
920895746 1:210048080-210048102 ACCACTAGGTATTGGGGAACAGG - Intronic
921829826 1:219714904-219714926 ACCACTAGCAATAGGAGAAGAGG + Intronic
922558728 1:226551554-226551576 GCCAGGAGGCCTTGGAGAAGTGG - Intronic
1062956910 10:1546549-1546571 ACCACAAGTCACTGGAGAAGGGG + Intronic
1068925326 10:62529869-62529891 ACCCCCAGGCATTATGGAAGTGG + Intronic
1074278037 10:112023630-112023652 AGCACAAAGCCTTGGAGAAGAGG + Intergenic
1078267419 11:9765613-9765635 GCCTCCAGGGAATGGAGAAGAGG + Intergenic
1078900952 11:15642332-15642354 CCCACCAGGCATTAGAAAATTGG + Intergenic
1079458882 11:20662233-20662255 TCCACAAGGGATGGGAGAAGAGG - Intergenic
1082226121 11:49709661-49709683 ACTACCAGGGACTGGAGAAGTGG + Intergenic
1083929610 11:65833576-65833598 CCCACCAGGCAGTGGGGAAGGGG - Intronic
1085739973 11:79070107-79070129 AACCCCAGGCAGTGGAGGAGAGG + Intronic
1086622965 11:88910079-88910101 ACTACCAGGGACTGGGGAAGTGG - Intronic
1086953128 11:92910704-92910726 ACCAGCAGGCACTGGAGTTGTGG + Intergenic
1088443193 11:109894757-109894779 ACCACCAGGCATTTGAGGAAAGG + Intergenic
1089539997 11:119184023-119184045 AGCACCAGGCAGTAAAGAAGAGG - Intergenic
1090376106 11:126290846-126290868 GAGACCAGGCATTGGTGAAGGGG - Exonic
1090733082 11:129588697-129588719 ACCATCAGCCCCTGGAGAAGTGG - Intergenic
1090909003 11:131101991-131102013 ACCACCAGACATTGTAAATGGGG + Intergenic
1093045446 12:14438689-14438711 GACACCAGTCATTGGAGTAGGGG + Intronic
1094776596 12:33736550-33736572 GGCATCAGGCATTGGGGAAGGGG - Intergenic
1104309063 12:127637286-127637308 GCCACCAGGCATTCCACAAGAGG - Intergenic
1107820186 13:44278752-44278774 TCCACCAAGCCTGGGAGAAGAGG + Intergenic
1112541266 13:100315724-100315746 ACCACCAGGCCACAGAGAAGAGG - Intronic
1115429979 14:33305869-33305891 AATACCAGGCATAGAAGAAGTGG - Intronic
1118311129 14:64693964-64693986 ACCACAAGGCACTGCAGCAGGGG - Intergenic
1119744903 14:77037236-77037258 ACCACCAGGGATTTGGGGAGGGG - Intergenic
1120855921 14:89212491-89212513 ACACCCAGGCACTGGAGAATGGG - Intronic
1120882417 14:89424389-89424411 AGCACCAGGCTTTTCAGAAGGGG - Intronic
1121301808 14:92877865-92877887 ACCACCAGGCAATGCACAAAAGG - Intergenic
1121311759 14:92939191-92939213 GCCACCATGCTCTGGAGAAGAGG + Exonic
1121332214 14:93056695-93056717 AACACCAGGCTCTGGAGGAGGGG - Intronic
1121439058 14:93937344-93937366 ACCAAGAGGCATTGTAGGAGGGG - Intronic
1121638721 14:95471306-95471328 GACACCAGGCTTTGGAGAAGGGG - Intronic
1124404173 15:29379452-29379474 AGCCCCAGGCAGAGGAGAAGGGG - Intronic
1125349531 15:38752887-38752909 TCCACCATGGGTTGGAGAAGGGG - Intergenic
1126008001 15:44276987-44277009 GTGAGCAGGCATTGGAGAAGGGG + Intergenic
1130807004 15:87333875-87333897 TCCACCAAACATTGGAGAATTGG + Intergenic
1130825025 15:87534959-87534981 GACACCAGGCTTTGGAGAATGGG - Intergenic
1133157719 16:3887487-3887509 AACACAGGGCATGGGAGAAGAGG - Intergenic
1134614071 16:15636136-15636158 ACCAAAACGCATTGGCGAAGTGG + Exonic
1135724511 16:24844494-24844516 AACAGCTGGGATTGGAGAAGAGG - Intergenic
1135734366 16:24918996-24919018 AGCACCAGCCATTGGAAAAAGGG + Intergenic
1136393805 16:29982062-29982084 TCCACTAGGCATTGGGGATGGGG - Intronic
1138100238 16:54246480-54246502 AGCAGGTGGCATTGGAGAAGTGG + Intronic
1139009717 16:62617134-62617156 ATCAGCAGGCATGGGAGCAGGGG - Intergenic
1139520990 16:67482683-67482705 AGCAGAAGGCATTGAAGAAGCGG + Exonic
1139893582 16:70270387-70270409 ACCAGCAGGGACTGGAGAGGTGG - Intronic
1141020954 16:80496023-80496045 ATCAACAGGCATTTGAGAAATGG + Intergenic
1142866606 17:2795217-2795239 ACCCCCAAGCAGTGGAGAAAGGG - Intronic
1146563424 17:33891194-33891216 ATCACCCGGCATTCCAGAAGTGG + Intronic
1147627572 17:41909898-41909920 ACCACCAGCCAGTGGGGTAGAGG - Intronic
1149998639 17:61417944-61417966 TCAACGAGGCATGGGAGAAGGGG - Intergenic
1151424866 17:74024443-74024465 TCCACCAGGATTTGGATAAGCGG - Intergenic
1154050102 18:10946466-10946488 AACACCAGGGAGAGGAGAAGTGG - Intronic
1156032039 18:32723757-32723779 AGCACCAGGGGTTGGAGAGGGGG + Intronic
1158782474 18:60667827-60667849 TCCACCAGGGATTGGACAACTGG + Intergenic
1161202197 19:3021474-3021496 GCCACCAGGCATTTGACATGTGG + Intronic
1163149624 19:15403265-15403287 ACCACCAGGCAGTGCGGCAGGGG + Intronic
1164257904 19:23545290-23545312 ACCCCCAGTCATTGGGGAACAGG + Intronic
1165561727 19:36686301-36686323 ACCTCAAGGCAAGGGAGAAGGGG + Intergenic
1165789476 19:38483009-38483031 TCCACCTGGCAGAGGAGAAGAGG - Exonic
1166020617 19:40025283-40025305 ACAAACAGGCAATGGAGAAAGGG - Intergenic
1166363680 19:42268103-42268125 CCCACTAGGCATTGGGGCAGGGG - Intergenic
1167648018 19:50716290-50716312 ACCCCCAGTCCTTTGAGAAGGGG - Exonic
1167763190 19:51462152-51462174 ACCACGAGGCATGAGAGATGGGG + Intergenic
1168448946 19:56448117-56448139 ACTGCCAGGCATTGGGGGAGGGG - Intronic
927206912 2:20616763-20616785 ACCACCAGGGAGGGGAGAGGGGG - Intronic
929895114 2:45953140-45953162 ACCACCTGGCCATGGGGAAGGGG - Intronic
929907440 2:46058504-46058526 AGAAACAGGCAGTGGAGAAGGGG + Intronic
931641549 2:64385077-64385099 CCCATCAGGCATGGGGGAAGTGG - Intergenic
933625607 2:84595016-84595038 ACCACCATGGATTAGAGCAGTGG + Intronic
937114183 2:119392523-119392545 CCCACCAGGCAGGTGAGAAGAGG - Intergenic
940767937 2:157810115-157810137 ACCCCAAGGCAGTGGAAAAGAGG + Intronic
944145402 2:196502802-196502824 ACCACCAGGCAGTGGAAAACAGG + Intronic
945946733 2:216002128-216002150 AACATCAGGCATTTGAGAGGTGG + Intronic
946961726 2:224992523-224992545 TCCAGCAGGAATAGGAGAAGTGG + Intronic
947675349 2:231974149-231974171 GCCACCAGAAATTGGTGAAGTGG + Intronic
1169879726 20:10333358-10333380 AGCACCAGGCATTTGTGGAGTGG - Intergenic
1170829186 20:19824939-19824961 TCGAGCAGGCCTTGGAGAAGAGG - Intergenic
1173620194 20:44430484-44430506 TCCACCAGGCCTTTGAGAAAGGG + Exonic
1177212754 21:18090980-18091002 ACTGCCAGGAAATGGAGAAGTGG - Intronic
1177218697 21:18162314-18162336 ACCACCAAGAATTAGGGAAGAGG - Intronic
1177844983 21:26278902-26278924 ACCAACAGTCAATGGAGAAATGG - Intergenic
1178120639 21:29466726-29466748 AACCCCATGCATTGGAGCAGTGG - Intronic
1180121626 21:45753971-45753993 ACCACGATGCATTTTAGAAGAGG - Intronic
1182123839 22:27802374-27802396 AACCCCAGGCAGTGGGGAAGGGG - Intergenic
1182933542 22:34197602-34197624 AGAACCAAGGATTGGAGAAGAGG - Intergenic
1183382006 22:37494921-37494943 CCATCCAGGCATTGGAAAAGGGG + Intronic
1183744985 22:39686901-39686923 GGCACCAGGCCCTGGAGAAGAGG + Exonic
1184297339 22:43533275-43533297 TCCACCAGCCATTTGAGATGGGG - Intronic
951996498 3:28736073-28736095 ACCTCCAGGCATGGGAAAAATGG - Intergenic
952436003 3:33273057-33273079 ACCACCAGGCTGGGGAGTAGAGG + Intergenic
952548214 3:34446089-34446111 AACCCCAGGTATTGGAGGAGGGG + Intergenic
952688904 3:36180591-36180613 ACCAACATGCATATGAGAAGAGG - Intergenic
953683895 3:45061079-45061101 ACAACCAGCCCTGGGAGAAGAGG - Intergenic
954039352 3:47872498-47872520 ACAACCATGTATTGGAGAACAGG + Intronic
954440049 3:50516808-50516830 GCCAGCAGGCATGGGAAAAGGGG - Intergenic
955202334 3:56862281-56862303 ACCAGTAGGCATTGGAGTAGGGG - Intronic
956798125 3:72734192-72734214 AGCACCAGGCTCTGGACAAGGGG - Intergenic
959762226 3:109978891-109978913 ACCACTAGACATGGGAGAAAAGG - Intergenic
960240686 3:115338440-115338462 AACACCAGACATTGGGCAAGAGG + Intergenic
961316331 3:126038248-126038270 TCCACTAGGCATTGGCCAAGTGG - Intronic
962626402 3:137229881-137229903 ACCACCAGGGAATGGGGATGGGG - Intergenic
964138153 3:153368579-153368601 ACAATCAGTCAATGGAGAAGAGG + Intergenic
968057688 3:195705299-195705321 AGCACCAGGCTCTGGAGAAGAGG + Intergenic
969107517 4:4818872-4818894 AGCCCCATGCATTAGAGAAGGGG + Intergenic
969157555 4:5224584-5224606 ACCACCAGGGAGTAAAGAAGTGG - Intronic
969621768 4:8282238-8282260 GACACCAGGCATTTGGGAAGGGG - Intronic
972702361 4:41506817-41506839 ACCAGCTGGTATTGGAGAATTGG - Intronic
975618390 4:76270600-76270622 AGCAGCAGGAATGGGAGAAGTGG - Intronic
975635007 4:76439465-76439487 ACCACCAGGCATTTGAGCATTGG + Intronic
979885489 4:126022904-126022926 ACCACCAGGAACTAGAGGAGAGG - Intergenic
982143041 4:152347401-152347423 AAGACCAGTCATAGGAGAAGTGG - Intronic
982559598 4:156913966-156913988 ACCAGCAGGGATTCTAGAAGGGG - Intronic
985724414 5:1508311-1508333 ATCAACAGGAATTGGGGAAGGGG - Intronic
986661462 5:10063827-10063849 ACCCCCAGGAATGGGAGAACAGG + Intergenic
987773101 5:22331338-22331360 ACCACCTGGCACTGGAGATGTGG - Intronic
989667097 5:43867251-43867273 ACCACCTTGAATTGGAGCAGGGG + Intergenic
990657568 5:57974158-57974180 ACCTACAGGCATTTGAGGAGTGG - Intergenic
990742071 5:58922561-58922583 GCCACCAGGGAGTGGAGCAGTGG + Intergenic
990787915 5:59443797-59443819 ATAACCAGTCAATGGAGAAGTGG + Intronic
993068127 5:83126627-83126649 TCTACCAGGCATTGCAGTAGTGG - Intronic
995687211 5:114783935-114783957 ACTACCAGGCAGTGGATAAGGGG - Intergenic
997375924 5:133397577-133397599 ACCACCCTGCAAGGGAGAAGAGG - Intronic
1002135386 5:177104487-177104509 ACCACCATGCCTGGGAGACGAGG + Intergenic
1004336444 6:14768782-14768804 ACCACCAGGGAAAGAAGAAGGGG + Intergenic
1004465542 6:15881741-15881763 ACACTGAGGCATTGGAGAAGTGG - Intergenic
1006018704 6:31103819-31103841 ACTGCCTGGGATTGGAGAAGGGG + Intergenic
1007725879 6:43915288-43915310 ACCACCAAGGTTTGGAGGAGTGG - Intergenic
1008718274 6:54316489-54316511 AAGACCAGGCTTTGGAGAAACGG - Intronic
1009213938 6:60896782-60896804 GCCACCAGGGTTTGGAGGAGGGG - Intergenic
1011971646 6:93231937-93231959 ACCACCAGTAATTGGTGAACTGG + Intergenic
1014873663 6:126628522-126628544 AACTCCAAGCTTTGGAGAAGTGG + Intergenic
1017893198 6:158656218-158656240 ACCGCCAGGCCTGGGAGAAGAGG - Intronic
1018955795 6:168409856-168409878 AGAACCAGGCAGTGGAGCAGTGG + Intergenic
1019003646 6:168777973-168777995 AACACCAGGCAGCGGAGATGGGG + Intergenic
1019300838 7:302694-302716 ACCAGCAGGCAGGGGACAAGGGG - Intergenic
1021322207 7:19226581-19226603 TCTAAAAGGCATTGGAGAAGTGG + Intergenic
1021728200 7:23570639-23570661 ATGTCCAGGCATTGGAGAGGTGG + Intergenic
1026972341 7:74476064-74476086 ACCACCAGGCATTGGAGAAGAGG - Intronic
1028017686 7:85736001-85736023 ACCACCATTCCTAGGAGAAGTGG + Intergenic
1028715647 7:93964280-93964302 AACAACAGGCACTGTAGAAGGGG - Intronic
1028879158 7:95859943-95859965 GCCACCTGGCATTGGTGATGTGG + Intronic
1032288419 7:130562609-130562631 ACTACCAGGCATTTGAAAGGTGG + Intronic
1032681737 7:134191673-134191695 ACCACCTTACTTTGGAGAAGGGG + Exonic
1034128846 7:148698353-148698375 ACCACCAGCCTCTGGAGAAACGG - Intronic
1034675414 7:152889364-152889386 AGGACCTGGCACTGGAGAAGTGG + Intergenic
1034778913 7:153859237-153859259 TGCACCATGCATTGCAGAAGAGG + Intergenic
1035624251 8:1059634-1059656 TTCACCAGGCATTTGTGAAGTGG - Intergenic
1038130807 8:24729095-24729117 CCTTCCAGGCATTTGAGAAGGGG - Intergenic
1039546753 8:38416059-38416081 ACCTGCAGGCACAGGAGAAGAGG + Exonic
1040487499 8:47887229-47887251 ACCACCAAGGAGAGGAGAAGAGG + Intronic
1044305984 8:90642008-90642030 TCTACCATGCATGGGAGAAGGGG + Intronic
1047040912 8:120994608-120994630 ACCAGCAAGTATTGGAGAAAAGG + Intergenic
1047329512 8:123873697-123873719 GCCACCAGGCATTGCTGGAGAGG - Intronic
1048000707 8:130377411-130377433 ACAAGCAGACATTGCAGAAGGGG + Intronic
1050517535 9:6460328-6460350 CCCACTAGGCCTTGGAGATGTGG - Intronic
1051941806 9:22515356-22515378 GTTATCAGGCATTGGAGAAGGGG - Intergenic
1053319829 9:37086839-37086861 ACATCCAGGCACTGGGGAAGTGG + Intergenic
1055039686 9:71856038-71856060 CTCACCAGACCTTGGAGAAGGGG - Intergenic
1055916717 9:81409601-81409623 AGGATAAGGCATTGGAGAAGGGG - Intergenic
1056750649 9:89348538-89348560 ACCAGCAAGTATTGGAGACGTGG + Intronic
1057241731 9:93417300-93417322 ACCACCAGCCAAGGGAGATGGGG - Intergenic
1057311096 9:93943726-93943748 ACCAGCAGGCAGGGGAGGAGAGG + Intergenic
1058288890 9:103212649-103212671 CCCACCAGGAATTGTGGAAGAGG - Intergenic
1062525436 9:136976350-136976372 ACCCCCGGGCACTGGGGAAGGGG + Intergenic
1186392289 X:9173081-9173103 TCCACCAAGAATTGGAGAATTGG + Intergenic
1186402844 X:9275525-9275547 ACCACCAGGCACAGGTGGAGTGG + Intergenic
1188570161 X:31575076-31575098 AAGACCAGGCATTGTAAAAGAGG - Intronic
1189502114 X:41571501-41571523 AACATCAGGCATGAGAGAAGGGG - Intronic
1189551878 X:42101917-42101939 ACTAACAGGCCCTGGAGAAGGGG - Intergenic
1191675103 X:63785129-63785151 AGCACCATGCAGTGGATAAGGGG - Intronic
1192227083 X:69236893-69236915 CACACCAGGCAGTGGAGAAGGGG - Intergenic
1192359828 X:70432481-70432503 AAAACCAGGGATGGGAGAAGAGG - Intronic
1192383973 X:70646466-70646488 CAAACCAGGCATTTGAGAAGGGG + Intronic
1192781053 X:74293912-74293934 AACATCAGGCATAGGAGGAGAGG - Intergenic
1193856788 X:86612308-86612330 ACCACCTGGTATTGGGGAAAGGG + Intronic
1194424669 X:93721738-93721760 ACCCTGAGGAATTGGAGAAGAGG + Intergenic
1195965956 X:110430541-110430563 ACCACCTTGTATTGGAGAAGAGG + Intronic
1198963159 X:142203793-142203815 ACCACCAAGAATCAGAGAAGAGG + Exonic
1199772195 X:150982397-150982419 ACCACCAGCCAATGGCAAAGTGG + Intronic