ID: 1026972344

View in Genome Browser
Species Human (GRCh38)
Location 7:74476072-74476094
Sequence CCCTCACCACCACCAGGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 332}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026972344_1026972354 13 Left 1026972344 7:74476072-74476094 CCAATGCCTGGTGGTGGTGAGGG 0: 1
1: 0
2: 2
3: 32
4: 332
Right 1026972354 7:74476108-74476130 TATTTTGCAGTTGGATGGTGTGG 0: 1
1: 0
2: 0
3: 26
4: 236
1026972344_1026972353 8 Left 1026972344 7:74476072-74476094 CCAATGCCTGGTGGTGGTGAGGG 0: 1
1: 0
2: 2
3: 32
4: 332
Right 1026972353 7:74476103-74476125 GTGGCTATTTTGCAGTTGGATGG No data
1026972344_1026972352 4 Left 1026972344 7:74476072-74476094 CCAATGCCTGGTGGTGGTGAGGG 0: 1
1: 0
2: 2
3: 32
4: 332
Right 1026972352 7:74476099-74476121 GGGTGTGGCTATTTTGCAGTTGG 0: 1
1: 0
2: 0
3: 13
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026972344 Original CRISPR CCCTCACCACCACCAGGCAT TGG (reversed) Intronic
900525969 1:3128860-3128882 CCCTCACTAACACCAGTCCTGGG + Intronic
900791241 1:4682366-4682388 CCCTCCCCACAACCATGCTTGGG + Intronic
901907669 1:12428313-12428335 CACTCACCTCCAGCAGGCAAGGG + Intronic
902780271 1:18700446-18700468 CCCTCACAACCACCAGTGAGGGG - Intronic
903674513 1:25055593-25055615 CCCCCACCACCACCGGGGAGAGG + Intergenic
904300369 1:29550009-29550031 CCCTCAACGCCACCAGTCACAGG - Intergenic
904301933 1:29559778-29559800 CCCTCACCAACTCCAAGGATGGG + Intergenic
904425001 1:30417399-30417421 ACCTCACCTCCTCCAGGTATGGG - Intergenic
904495016 1:30881672-30881694 CCCTCAGCAGCAGCAGGCAGAGG - Intronic
904916977 1:33977251-33977273 CCCTCACCACCAACATTCACTGG - Intronic
904947853 1:34212536-34212558 CCCACACAACCACCAGCCACAGG - Intronic
905126274 1:35718287-35718309 CCCTCCCCACCCCCAGCAATGGG + Intronic
905343803 1:37297803-37297825 CACTCATCATCACCAGACATAGG - Intergenic
905347432 1:37320377-37320399 CACTCACCACCAGCAGGCACAGG + Intergenic
905408767 1:37754130-37754152 CCCTCACCACCACCTGGATCAGG + Intronic
906661911 1:47589019-47589041 CCCCCACCACCCCCCGGCAAAGG + Intergenic
907428350 1:54395641-54395663 CCCTCACAACCACTATGCAAAGG + Intronic
911370787 1:96992568-96992590 CCCTTCCCACCTCCAGTCATAGG - Intergenic
911960986 1:104301908-104301930 CCTCCACCACCACCAGTCCTTGG - Intergenic
912279181 1:108295178-108295200 CCCTCCTGACCACCAGGCCTGGG - Intergenic
912289045 1:108399179-108399201 CCCTCCTGACCACCAGGCCTGGG + Intronic
913513060 1:119580179-119580201 CCCTCACCCCCAACAGGCCCCGG - Intergenic
915115968 1:153599745-153599767 CCTTCACCACCACAAGGCCTTGG + Intergenic
915205710 1:154269062-154269084 CCCTCCCCAGCGCCAGTCATGGG + Intronic
915637987 1:157199670-157199692 CTCACACCACCCCCAGGCAGAGG - Intergenic
920029372 1:203027202-203027224 TCCCCACCCCCACCAGGCCTCGG - Intronic
920054105 1:203180417-203180439 CCCACACCACCAGCAGCCCTGGG - Intronic
920101846 1:203521857-203521879 CCCTCAGCACCAGCAGGCACAGG + Intergenic
920229601 1:204461705-204461727 GCCTCACCACCTCCAGGTTTTGG - Intronic
920388280 1:205582911-205582933 CCCAGAACACCACCAGGCAGGGG + Intronic
920502484 1:206494039-206494061 TCTTCACCACCCCCAGGCAAGGG - Intronic
921038955 1:211411213-211411235 CCCTCACCAACACTTGGTATTGG - Intergenic
922028270 1:221773725-221773747 TCCTCATCCCCACCAGGCTTGGG - Intergenic
922343287 1:224674673-224674695 CCCTACCCACCACTAGGCTTAGG - Intronic
922803318 1:228373723-228373745 CCCTCCCCACCTCCAGGCACGGG - Intronic
922894878 1:229092136-229092158 TTCTCACCACCACCAGCCTTTGG - Intergenic
922930079 1:229382123-229382145 TCCTCCCCACCCCCAGGGATGGG + Intergenic
924422953 1:243926163-243926185 CCCCCACCTCCAGCAGGTATTGG + Intergenic
1062858210 10:790100-790122 CCCTGACCTCCAGCAGGCACTGG + Intergenic
1062939394 10:1410170-1410192 CCATGACCACGACCAGGCCTCGG - Intronic
1063222242 10:3979870-3979892 TCCTCACCCCCACCTGGCCTTGG - Intergenic
1063574754 10:7251813-7251835 CCCTCACCAGCCACAGGCACAGG + Intronic
1065639971 10:27771439-27771461 CCCCCACCACCACCACGCCGTGG + Intergenic
1067003373 10:42638381-42638403 TCCTCGCCACCACCTGGCACTGG + Intronic
1067837015 10:49647856-49647878 CCCTCTCCACCACCTCTCATGGG + Intronic
1068810106 10:61245730-61245752 ACCTCAGCACCACCAGTTATTGG + Intergenic
1069464201 10:68623677-68623699 CCAGCAACACCACCAGGCAACGG + Intronic
1070400905 10:76052834-76052856 CCCTCACCACCCCCAGCCTTGGG + Intronic
1070658011 10:78284393-78284415 CCCTCCTCACCACCATGCAGAGG - Intergenic
1070922379 10:80196342-80196364 CCCCCACCACCACCTGCCACAGG + Intronic
1071471296 10:85985739-85985761 CCCCCACCACCCCCAGGTGTTGG - Intronic
1071488114 10:86116702-86116724 CCCCCACCACCACCATTTATGGG + Intronic
1072541083 10:96398376-96398398 CCCCCGCCACCACCATGCCTTGG + Intronic
1073180326 10:101579430-101579452 TCCTCAGCACCCCCAGCCATGGG + Exonic
1075055808 10:119217613-119217635 TCCCCACCACCACCACCCATGGG - Intronic
1075877625 10:125821528-125821550 CCATCACCACCACTATCCATTGG - Intronic
1076317107 10:129550405-129550427 CCATCACCACCACCCAGCACTGG + Intronic
1076573632 10:131449356-131449378 CCCTCCCCACAACCAGGCCAAGG - Intergenic
1077226957 11:1442755-1442777 TCCCCACCACCACCAGGCTGTGG - Intronic
1080588327 11:33700493-33700515 CCCCCGCCACCACCCGGCCTGGG - Exonic
1081721762 11:45294590-45294612 ACCCCACCACCACAAGGTATGGG - Intergenic
1081745778 11:45471393-45471415 CTCTTCCCTCCACCAGGCATTGG + Intergenic
1081873366 11:46392944-46392966 CCCTCACCACCTCCGGCCCTCGG - Intergenic
1083158113 11:60838005-60838027 CCTCCACCTCCACCAGGCCTAGG - Intergenic
1083202265 11:61127639-61127661 CCCTCACCTCCACCAGATATGGG - Exonic
1083752984 11:64772137-64772159 TCTTCACCTCCAACAGGCATCGG + Intronic
1083968063 11:66055142-66055164 CCACCACCTCCACCAGGCCTTGG + Exonic
1084933347 11:72574150-72574172 CCCTCACCCACAACAGGTATTGG - Intergenic
1086085502 11:82950526-82950548 CCCCCACCCCCAACAGGCCTTGG + Intronic
1088287838 11:108206361-108206383 GGCTCACCACCAGCAGGCATGGG - Intronic
1088882034 11:113980007-113980029 CCATCACCACCACCAGACATGGG + Intronic
1088889246 11:114031901-114031923 CCCACACCACCCCAAGGCCTGGG + Intergenic
1089598360 11:119597321-119597343 CCCTCACCCACCCCAGGCAGAGG - Intergenic
1089606962 11:119647073-119647095 CCTTCACCATCACCATCCATGGG + Intronic
1089685154 11:120141962-120141984 ATCTCACCACCACCTGGTATAGG - Intronic
1090057003 11:123431939-123431961 CCCTGCCCTCCACCAGGCAAGGG - Intronic
1090187440 11:124747506-124747528 CCCTCACCGCCCTCAGGGATCGG + Exonic
1091362285 11:134987119-134987141 CCCTTTCCACCACCAGTCCTGGG - Intergenic
1091776015 12:3185469-3185491 CCCTCAAATCCACCAGCCATGGG - Intronic
1092094146 12:5827884-5827906 CCCTCACCACTGCCTGGCAGGGG + Intronic
1092098632 12:5864568-5864590 CCCTCACCCCCACCAGGACACGG + Intronic
1093715965 12:22382062-22382084 CTCCCACCACCACCATGTATGGG - Intronic
1094008735 12:25784174-25784196 CTCTCACCACACACAGGCATGGG + Intergenic
1095183101 12:39168629-39168651 TCCTCACCACAAGCAGACATTGG + Intergenic
1095556617 12:43513898-43513920 CCCTCACCCGCAACAGGCCTGGG - Intronic
1097043717 12:56171931-56171953 CCACCACTACCACCAGGCACTGG - Exonic
1098317230 12:69205706-69205728 CCCTCCCCACCTCCAGCCCTTGG + Intergenic
1099203848 12:79705763-79705785 CTCTCACCATCAACAGGAATTGG + Intergenic
1101635858 12:106540951-106540973 GCCACAGCACCACCAGGCAGTGG + Intronic
1101924349 12:108958797-108958819 CCCTCACACCAACCAGGCATCGG - Intronic
1104863310 12:131936924-131936946 CCATCACCACAGCCAGACATAGG + Intronic
1107285107 13:38781819-38781841 CCATCACCACCTCTAGGCACAGG + Intronic
1107942102 13:45383941-45383963 CCCTCATCACCCCCTGGCTTAGG - Intergenic
1110060670 13:71034207-71034229 CCCTGCTCACCACCAGGCAGAGG + Intergenic
1113877110 13:113601484-113601506 CCCTCACCCTCACCAGGCTCTGG + Intronic
1114768081 14:25397549-25397571 CCCTCAACATCCCTAGGCATAGG - Intergenic
1116779564 14:49221671-49221693 CCCTCTCCACTCCCAGGAATCGG + Intergenic
1118895589 14:69942994-69943016 CCCCCACCACCAGCAGCCACAGG - Intronic
1118905297 14:70019076-70019098 GCCTCAGCCCCACCAGGCCTTGG - Intronic
1119443949 14:74648195-74648217 CCCTCTCCAGCACCAGGAAGAGG + Intergenic
1121023623 14:90598442-90598464 CTCTCTCCATCACCATGCATGGG + Intronic
1121336926 14:93083293-93083315 CCATGACCAGCAGCAGGCATGGG + Intronic
1121685075 14:95829706-95829728 CCCTTACTACCACCAGCCACCGG + Intergenic
1122252309 14:100448667-100448689 CCATCACCACCACAAGGCTATGG - Intronic
1202859723 14_GL000225v1_random:73456-73478 ACCACACCACCAGCAGGCCTCGG - Intergenic
1123937337 15:25200360-25200382 ACCTCAGCACCACCAGGCACCGG - Intergenic
1124426500 15:29567676-29567698 CCCTGAGCACCAGCAGGCAGAGG + Intronic
1124483681 15:30098347-30098369 CCCCCCCCCCCACCAAGCATGGG - Intergenic
1124490135 15:30150409-30150431 CCCGCCCCCCCACCAAGCATGGG - Intergenic
1124519898 15:30398879-30398901 CCCCCCCCCCCACCAAGCATGGG + Intergenic
1124538755 15:30567343-30567365 CCCCCGCCTCCACCAAGCATGGG - Intergenic
1124753397 15:32387918-32387940 CCCGCCCCCCCACCAAGCATGGG + Intergenic
1124759895 15:32440237-32440259 CCCACCCCCCCACCAAGCATGGG + Intergenic
1124956488 15:34363736-34363758 CCCCCACCCCCACAAGGCAGAGG + Intronic
1125702574 15:41700399-41700421 CCCTCCCCACCAACAGGCTCTGG + Intronic
1125880674 15:43191541-43191563 CTCTCACCAGCGCAAGGCATGGG - Exonic
1128667328 15:69548067-69548089 CCCTCAGGACCACCAGGAATGGG + Intergenic
1129169848 15:73800960-73800982 CTCTCACTGGCACCAGGCATAGG + Intergenic
1130828035 15:87569653-87569675 CCATCCCCACCACCAAGCAAGGG + Intergenic
1130993163 15:88888874-88888896 CCCCCAGCACCCCCAGGCTTGGG - Intronic
1132310642 15:100854988-100855010 CCCTCTCCACCAACACTCATGGG + Intergenic
1132366925 15:101264568-101264590 CCCTCACAACCTCCAGGCAATGG + Intergenic
1132899132 16:2243956-2243978 CCCTCCCCTCCACCAGGCTCCGG + Intronic
1133020743 16:2965817-2965839 TCTTCACCCCCACCCGGCATGGG - Intronic
1134374641 16:13660498-13660520 CCATCAGGACCAGCAGGCATTGG + Intergenic
1135948067 16:26882954-26882976 CCCCCACCCCCAACAGGCACTGG - Intergenic
1139648656 16:68350411-68350433 TCCTCACCAGCACCTGGCATTGG + Intronic
1140565465 16:76036472-76036494 CCCTCACCTGAACCAGGCAGTGG + Intergenic
1141512649 16:84522718-84522740 CCCTCATCACCTCCAAGCCTGGG - Intronic
1141603319 16:85139126-85139148 CCCTCACCCCCAACAGGACTCGG - Intergenic
1142362786 16:89635255-89635277 CCCTCACCACCACCAGCTCCTGG + Intronic
1142740749 17:1930610-1930632 CCCTCACCACCACAAGAAGTGGG - Intergenic
1143401720 17:6650171-6650193 CCCCCACCACCAACACACATTGG + Intronic
1143786458 17:9259512-9259534 CCCTCATCACCGCCGGGCCTCGG - Intronic
1144629628 17:16864327-16864349 CCCTCACAACCACCACACATTGG - Intergenic
1144651800 17:17011790-17011812 CCCTCACAACCACCACACATTGG + Intergenic
1144874529 17:18390474-18390496 CCCTCACCACCTCCACCCCTAGG + Intergenic
1145157702 17:20553947-20553969 CCCTCACCACCTCCACCCCTAGG - Intergenic
1145772109 17:27500767-27500789 CACTCACCACCTTCAGGGATTGG + Intronic
1146057469 17:29588669-29588691 CAGTCACCACCAGCAGGCCTGGG + Intronic
1146300472 17:31685394-31685416 ACCACCCCACCACAAGGCATGGG + Intergenic
1147155124 17:38540813-38540835 CCCTCCCCACCCCCAGGTCTTGG + Intronic
1147444502 17:40466668-40466690 TCCTCTCCTCCACCATGCATTGG + Intergenic
1147727732 17:42577290-42577312 TCTTCACCACCACCTGGCAGAGG + Exonic
1148052592 17:44776439-44776461 CCCTAACCTACACCAGGCACCGG - Intronic
1148386616 17:47238709-47238731 CCCTCACCATCACACGGCGTGGG - Intergenic
1148469434 17:47884228-47884250 CTCTCACCACCCACAGGCCTGGG - Intergenic
1148907326 17:50919709-50919731 CCCTCTCCGCCCCCCGGCATCGG + Intergenic
1149597475 17:57872818-57872840 CCCTCTCCACTCCCAGGCTTGGG + Exonic
1149681973 17:58513619-58513641 CCCTCCCAACCACCAGGGAGGGG + Intronic
1149848631 17:60022000-60022022 CCCTCACCACCTCCACCCCTAGG - Intergenic
1149861538 17:60124524-60124546 CCCTCACCACCTCCACCCCTAGG + Intergenic
1151905132 17:77042995-77043017 CCTCCATCACTACCAGGCATAGG - Intergenic
1153004677 18:487303-487325 CCCTCAAAACCACCAGCCCTAGG - Intronic
1153894016 18:9542958-9542980 CCCTCACCTACACCAGGAACTGG + Intergenic
1155044813 18:22094526-22094548 CCCTCGCCTCCACCCAGCATGGG - Intronic
1155870021 18:31015820-31015842 ACCTCACCCCCACCAAGCCTTGG - Intronic
1156503825 18:37576677-37576699 CCCTCACCACCATCAGGGCCAGG - Intergenic
1159756320 18:72370588-72370610 CTCTCACCTGCTCCAGGCATGGG + Intergenic
1160106428 18:75982634-75982656 CCCTGACCACCCCAAGGGATGGG + Intergenic
1160321283 18:77898015-77898037 CCATCACAACCACCAGCCAACGG + Intergenic
1160515856 18:79478838-79478860 CCCAGAACAGCACCAGGCATGGG + Intronic
1160662085 19:305984-306006 CCCTCAGCAACCCCAGGCGTGGG - Exonic
1161047867 19:2145954-2145976 CCCGCACCACCAGCAGGGCTGGG - Intronic
1161209997 19:3061475-3061497 CCCCCGCCACCCCCAGGCAGTGG + Intronic
1162058649 19:8081189-8081211 CCCTTGCCACCTCCAGGCAGAGG + Intronic
1162729756 19:12711266-12711288 CCACCACCACCCCCAGGCAGGGG + Intronic
1163250346 19:16122999-16123021 CCCTCCCCTGCACCAGGCAGTGG + Intronic
1163522899 19:17802488-17802510 CATTCACCACCATCAGACATGGG - Intronic
1165861220 19:38910604-38910626 CCACCACCACCACCAGCCAGAGG - Exonic
1166314053 19:41978741-41978763 CCTTCATCACCAGCAGGTATCGG + Exonic
1166677031 19:44746937-44746959 CCCACAACACCAGCAGGCAGGGG + Intergenic
1166851921 19:45765348-45765370 CCCCCAGCACCACCAGGGCTTGG + Exonic
1167100092 19:47399308-47399330 CCCTTCCCAGCACCAGGCAGGGG + Intergenic
1167103166 19:47416572-47416594 CCCCCACCAACCCCAGGGATGGG + Intronic
1167271520 19:48509099-48509121 CCTTGACCCCCACCAGACATGGG + Intronic
1167462812 19:49635356-49635378 CCCTCACCCCCACCAGGCTTAGG + Exonic
925280730 2:2682847-2682869 GCCTCCTCACCACCAGGCCTGGG - Intergenic
925591444 2:5513833-5513855 ACCTCAGCACCTCCAGGCCTTGG - Intergenic
926920619 2:17936554-17936576 CACTCCTCACCACCAGACATAGG - Intronic
927276523 2:21266926-21266948 CCTTCACCACCACTAAGCATGGG - Intergenic
927489340 2:23510436-23510458 CCATCACCACCACCATGGCTGGG - Intronic
927879877 2:26682750-26682772 CCCTCATCTCCACCTTGCATGGG + Intergenic
928053512 2:28026569-28026591 TCCTCCCCACCAACAGGCACCGG - Intronic
928270916 2:29853845-29853867 CCCTCCCCACCTCCTGGCTTTGG + Intronic
932894334 2:75624475-75624497 CACTCACCACCAACAATCATAGG - Intergenic
935337531 2:102031040-102031062 CCTTCACCTAAACCAGGCATTGG - Intergenic
935900645 2:107788596-107788618 CCCACACCACCACTGGGCACTGG - Intergenic
936099509 2:109562868-109562890 CCCTCACCAAATTCAGGCATAGG - Intronic
937908635 2:127064761-127064783 CACTCACACCCACCAGGCAGTGG + Intronic
937982451 2:127623509-127623531 CCCTCCCAGCCACCAGGCACAGG + Intronic
938063511 2:128269323-128269345 CCCCAACCACCACCAGGCCTTGG - Intronic
939607731 2:144273522-144273544 CAATCAACACCACCAGGCAGGGG + Intronic
940148494 2:150573594-150573616 CCCTACCCACCCCCAGACATTGG - Intergenic
941322358 2:164071707-164071729 TCCTTACCACCACCATTCATTGG - Intergenic
942017040 2:171828085-171828107 CCCTCACCCAAACCAGGCAATGG - Intronic
942401444 2:175608076-175608098 CCCACACCCCTCCCAGGCATGGG + Intergenic
942840020 2:180349012-180349034 CCCTCACCTCCACCAGTCCATGG - Intergenic
943451124 2:188043723-188043745 CCCTCACCCCCAACAGGCCCTGG - Intergenic
944573680 2:201071183-201071205 CCCTCACCACCCCCAGGAAATGG + Intronic
946352458 2:219164226-219164248 CACTCACCAACAACAGGCAGTGG + Exonic
946410658 2:219513662-219513684 CCCTTGCCACAACCAGGCTTCGG - Intergenic
946691024 2:222308273-222308295 CTCTCACCACCTCCAGGGGTAGG + Intergenic
948401871 2:237691311-237691333 CCCGCGCCACCTCCAGGCACAGG - Intronic
1168927504 20:1594983-1595005 CCCCCACCTCCCCCAGACATTGG - Intronic
1169064240 20:2685182-2685204 CTCTCCCCAACACCAGGAATAGG + Intergenic
1169878486 20:10322780-10322802 CTTTCACCACCTCCAGGCTTGGG - Intergenic
1170231473 20:14051490-14051512 CCCTCACCCCCACCATACTTTGG - Intronic
1171029937 20:21668521-21668543 CTCTCAACACCCCCAGGCATTGG - Intergenic
1171971589 20:31568351-31568373 CCTCCACAACCACCAGGCAGTGG + Intronic
1172330786 20:34074855-34074877 CCATCACCACCTCCAGGAAGGGG + Intronic
1173038260 20:39433995-39434017 CCCTCACCCCCACCCAGAATTGG + Intergenic
1173525357 20:43728302-43728324 CCTTAACCACCACCAAGAATAGG - Intergenic
1174775558 20:53340109-53340131 CTCTTCCCCCCACCAGGCATTGG - Intronic
1175240884 20:57547719-57547741 CCCTCATCACCACCTGGCAAGGG - Intergenic
1175259108 20:57663758-57663780 CCCTCAACACCTCCAGGTCTGGG - Intronic
1175812508 20:61866105-61866127 GCCACACCACCCCCTGGCATGGG + Intronic
1178899505 21:36587953-36587975 CCTTCACCACCCACAGGGATGGG - Intergenic
1179888032 21:44322749-44322771 CACTCAGCATCACCAGGCACCGG - Intronic
1180059507 21:45377382-45377404 CCCTCTCCAGTACCAGGCAGAGG + Intergenic
1180851507 22:19024046-19024068 CCCTCACCACCACCTGGGGATGG - Intergenic
1181173863 22:21025281-21025303 CACACACGACCACCAGGCCTGGG + Intronic
1181932391 22:26412838-26412860 CCACCACCACCACCAGCAATAGG + Intergenic
1181951099 22:26554432-26554454 CCCTCACCCCCACCCACCATGGG + Intronic
1181979228 22:26754084-26754106 CCCTCCCCACCTCCACGCAAAGG - Intergenic
1182475643 22:30574930-30574952 TCCCCACCACCACCAAGCCTGGG - Intergenic
1183364293 22:37399091-37399113 CCCTCCCCACTCCCAGGGATGGG + Intronic
1184072515 22:42154779-42154801 CCCCCACCACCAGCAAACATGGG - Intergenic
1184155279 22:42662801-42662823 CCCTCACCCCCACGAGTCCTGGG - Intergenic
1184186037 22:42866147-42866169 GCATGACCACCACCAGGCACAGG - Intronic
1184488424 22:44795546-44795568 CCCTCACCAGCAATAGGCACTGG + Intronic
950040598 3:9917033-9917055 CTCCCACCAACACCAGGCTTGGG - Intergenic
953006019 3:38980037-38980059 CCCACACCAGCACCAGGCCCAGG + Intergenic
953687415 3:45088861-45088883 CCCCCCTCACCCCCAGGCATGGG + Intronic
953790337 3:45942599-45942621 CCCTCTCCACTACAAGGCACTGG + Intronic
953844448 3:46416348-46416370 CCCTCCCTATCCCCAGGCATCGG - Intergenic
953907734 3:46876690-46876712 CCCCAACCACCCCCAGCCATTGG - Intronic
954452811 3:50580784-50580806 CCCACACCACTACCAAGCAGGGG - Exonic
954541111 3:51393354-51393376 CCCTCAGCAACAGCAGACATGGG + Exonic
954712497 3:52512119-52512141 CCCTCGCATCCACCTGGCATGGG + Intronic
955244618 3:57212945-57212967 CCCTCACCTCCGACAGGCCTCGG + Intronic
955586674 3:60485639-60485661 CCCCCACCCCCAACAGGCCTTGG - Intronic
955661800 3:61307493-61307515 TCCCCACCACCACCAGTCATGGG - Intergenic
956632628 3:71331370-71331392 CCCTCCCCACCCCCCGCCATGGG + Intronic
958499223 3:94884620-94884642 CCCTCACCCCCAACAGGCCCTGG + Intergenic
958627828 3:96648687-96648709 CCCAACCCACCACCAGCCATTGG + Intergenic
959283268 3:104374528-104374550 CCCTCACCCCCGACAGGCCTCGG - Intergenic
961073963 3:123964241-123964263 CCCTCACCACCACCTCCCTTAGG - Intergenic
961150278 3:124631949-124631971 GCGTCACCACCACTAGGCCTTGG + Intronic
961309657 3:125987888-125987910 CCCTCACCACCACCTCCCTTAGG + Intergenic
961366346 3:126402194-126402216 CCCTCACCACCCCCAGGACTGGG - Intronic
961443512 3:126966951-126966973 CCCACCCCATCACCAGGCAAGGG - Intergenic
961659757 3:128462499-128462521 CCACCACCACCACCGTGCATGGG - Exonic
962300996 3:134243070-134243092 CCCTCCTCCCCACCAAGCATGGG + Intronic
962420988 3:135229128-135229150 CCCTCACCACCACCAGAGGAGGG + Intronic
964168534 3:153738440-153738462 CCCTCACCCCCGACAGGCACTGG - Intergenic
968881172 4:3300952-3300974 TCCTCACCACCCCCAGGTCTAGG - Intronic
968986928 4:3880605-3880627 CCCGCCCCGCCACCAGGCCTGGG + Intergenic
969300323 4:6293613-6293635 CCCTCTCCCCCACCAGGCCCGGG + Intronic
969448201 4:7257360-7257382 CCCCCACCACCCCCAGGCCTGGG - Intronic
969665852 4:8557311-8557333 CCCTCCTCACCTCCAGGCCTCGG - Intergenic
970601465 4:17643784-17643806 TCCTCACCACCCACAGGCACTGG + Intronic
972371793 4:38431126-38431148 ACCTCACCACCTGCAGGCACTGG - Intergenic
972841292 4:42932883-42932905 TCCTCTCCACCTCAAGGCATAGG - Intronic
975064951 4:70049231-70049253 CCTTCCCCACCACCAGGCCCTGG + Intergenic
975355884 4:73403429-73403451 CCTTGACCTTCACCAGGCATAGG - Intronic
975379457 4:73681526-73681548 CCCCCACCACCCCCAGGCTCTGG - Intergenic
975443815 4:74440105-74440127 CCCTCACCAAAACCAGGCTGTGG + Intergenic
976373496 4:84317581-84317603 ACCTCACCACCACCCTGCCTTGG - Intergenic
978150539 4:105428657-105428679 CCCCCACCCCCAACAGGCCTCGG - Intronic
979776022 4:124589442-124589464 CCCTCACCCCCAACAGGCCCTGG - Intergenic
980944003 4:139301648-139301670 CCGCCGCCACCACCAGGCCTCGG - Exonic
985553188 5:543498-543520 CCCTCAGCTGCACCAGGCCTTGG - Intergenic
985567194 5:625056-625078 GCCTCACCAGCACCAGCCATGGG - Intronic
986574107 5:9194928-9194950 CCCTTACCACCTCCAGGCAGTGG - Intronic
993236074 5:85311823-85311845 CACTCACCATTGCCAGGCATGGG + Intergenic
993256170 5:85592490-85592512 CCCCCACAACCACAACGCATGGG + Intergenic
996204464 5:120714975-120714997 CCCCCACCACCAACAGGCCCTGG - Intergenic
996804685 5:127441278-127441300 CCCTCACCAGCAACAGGGATTGG - Intronic
996874714 5:128228084-128228106 CCATCACCACAGCCAGGCAGGGG - Intergenic
996969259 5:129343886-129343908 CCCTCACTCCCATCAGTCATAGG + Intergenic
998442165 5:142171686-142171708 CCCTCACCCCCACCAGCTTTTGG - Intergenic
999310129 5:150546540-150546562 CCCTCCCCAACACCAAGCACAGG - Intronic
999754298 5:154653159-154653181 CCCTCCCCACCCCCTGGCAGTGG - Intergenic
1002348207 5:178562722-178562744 CCCCCCCCACCACCAGCCAGCGG - Intronic
1004900668 6:20190850-20190872 GCCTGACCACCACCAGGGACAGG + Intronic
1005475532 6:26204134-26204156 CCCTCTCCACCACCAAGCCAAGG - Intergenic
1006962621 6:37949426-37949448 CTCTCCCCACCACCAAGCAGTGG + Intronic
1007243094 6:40441268-40441290 CCCTCACCCCATCCATGCATGGG - Intronic
1007573054 6:42907145-42907167 CCCTCATCTCCTCCAGGCACAGG + Intergenic
1011551809 6:88537223-88537245 TCCCCACCACCCCCAGCCATTGG - Intergenic
1012212295 6:96535441-96535463 CCATCACCACCACCACGAAGCGG - Intronic
1014653771 6:124073804-124073826 CCCCCACCCCCACCGGGCAGGGG + Intronic
1017911186 6:158794321-158794343 GCACCACCACCACCAGGCTTTGG + Intronic
1017913623 6:158816159-158816181 CCATCCCCACCACCAGCCCTTGG - Intronic
1018698013 6:166405675-166405697 CACTCACCACCACCAGCCCCAGG - Intergenic
1018979351 6:168590158-168590180 ACCTGACCACCACCAGGCTGGGG - Intronic
1019430823 7:998225-998247 CCCCCACCACCAGCAGACAAGGG - Intronic
1019583221 7:1779727-1779749 CCCTCTGCACCACCAGTCATAGG + Intergenic
1019602078 7:1889830-1889852 CCCTCACCCCACCCAGGCAGAGG + Intronic
1019644519 7:2121839-2121861 CCCTCTCCAGCACCGGGCAGGGG + Intronic
1020131130 7:5559148-5559170 CCCTCACCACCCCCAGGCTCGGG + Intronic
1024883323 7:54114052-54114074 CCCTCACCACCTGCTAGCATGGG + Intergenic
1026882915 7:73919042-73919064 CCCTGACCACCACCACCCACAGG - Intergenic
1026893964 7:73999585-73999607 ACCTCAGGACCACCAGGGATTGG - Intergenic
1026937530 7:74267123-74267145 CGCACACCACCACCAGGCCGGGG + Intergenic
1026972344 7:74476072-74476094 CCCTCACCACCACCAGGCATTGG - Intronic
1027239875 7:76320142-76320164 TCCCCACCTCCCCCAGGCATAGG + Intergenic
1027677352 7:81176996-81177018 CCCTCACCCCCAACAGGCCCTGG + Intronic
1027777619 7:82486194-82486216 CCCCCACCTCCAACAGGCCTTGG + Intergenic
1027810421 7:82889320-82889342 CCCTCACCACCAGGATGCTTAGG + Intronic
1027858211 7:83540025-83540047 CACTCACCACCACTATGCCTGGG + Intronic
1028798138 7:94928599-94928621 ACCTCACCACCTACAGTCATAGG + Intronic
1030108693 7:106008390-106008412 CCCTTACCACCACTAGGCCCAGG - Intronic
1031244371 7:119289499-119289521 CCCTCACCATCACCAATCTTGGG - Intergenic
1032053156 7:128662412-128662434 AGCTCAACACCACAAGGCATGGG - Intergenic
1032483257 7:132263307-132263329 CACTCACCACCACCCTGCACAGG + Intronic
1033779357 7:144650699-144650721 CCCCCACCGCCACCCGCCATGGG + Intronic
1034200682 7:149281495-149281517 GCCACACCACCACCTGGCAAAGG - Exonic
1037893096 8:22634412-22634434 CCGTCACCACCACCATGCCCGGG - Intronic
1039599921 8:38827781-38827803 CCCTCACCAGAAGCAGGCACTGG - Intronic
1039838538 8:41277222-41277244 CCCTCACCACCATCCTGCACTGG + Intronic
1039952284 8:42181737-42181759 TCCCCACCACCCCCATGCATGGG + Intronic
1040430610 8:47338147-47338169 CACACACCACCACCAGGAAAGGG - Intronic
1042968764 8:74385332-74385354 CCCCCACCACCAACAGGCCCCGG + Intronic
1043847001 8:85175328-85175350 CCCTCACCACAACCTGGCCATGG + Intergenic
1047271810 8:123367533-123367555 TCCCCACCACCACCAGGCACAGG - Intronic
1049255072 8:141609331-141609353 CCGTCACCCACCCCAGGCATCGG - Intergenic
1049276092 8:141720857-141720879 CCCTCAGGACCTCCAGGAATGGG - Intergenic
1049307054 8:141909636-141909658 CCCTCATCACCCCCAGGCCTCGG - Intergenic
1049435980 8:142586473-142586495 CCCCCACCACAGCCAGGCGTGGG + Intergenic
1053266121 9:36714755-36714777 CCCTCCCCTCCACCAGGCACCGG + Intergenic
1053562589 9:39211201-39211223 ACCTCATCACCACCTGGGATGGG + Intronic
1053828395 9:42049193-42049215 ACCTCATCACCACCTGGGATGGG + Intronic
1054134561 9:61407838-61407860 ACCTCATCACCACCTGGGATGGG - Intergenic
1054602164 9:67138261-67138283 ACCTCATCACCACCTGGGATGGG - Intergenic
1055426193 9:76199589-76199611 CCCTGACCACCACCAAGGATAGG - Intronic
1055945088 9:81686852-81686874 CCCTCACCATCACCAATGATGGG + Intronic
1056465427 9:86848927-86848949 CCCTCACCACCGACAGGCCCTGG + Intergenic
1056493133 9:87127621-87127643 CATTCACCACCACCTGACATGGG + Intergenic
1056942173 9:90965014-90965036 TCCTCAGCACCAGCAGGCCTGGG + Intergenic
1059481899 9:114597554-114597576 CACTCCCCATCTCCAGGCATTGG + Exonic
1061664101 9:132150306-132150328 CCCTCACCTCTACCTGGCACAGG - Intergenic
1062146602 9:134992839-134992861 CCCTCACCACCACCTCGCCAGGG + Intergenic
1062304294 9:135894273-135894295 CCATCACCAGCACCTGGCCTAGG + Intronic
1062337664 9:136079507-136079529 CCCTCCTCACCCGCAGGCATGGG + Intronic
1062464710 9:136675870-136675892 CCCTCCCCACCACCTTGCACAGG + Intronic
1062640265 9:137515123-137515145 CCCCCACCACCGCCAGGGCTGGG - Intronic
1185705435 X:2263023-2263045 CCCTCCCCACCCCCAGGCCCTGG - Intronic
1186204960 X:7191524-7191546 CCCTCACCTCCACCAGGCGGAGG - Intergenic
1186205577 X:7196849-7196871 CTCTCACCACCAGCAGCCAGAGG + Intergenic
1188123719 X:26341696-26341718 CCCTCACCACCACCAACCCCAGG - Intergenic
1189254744 X:39629224-39629246 CACTCACAACAACCAGGGATAGG + Intergenic
1189861971 X:45281969-45281991 CCCTCACCCCCAACAGGCCCTGG + Intergenic
1190128611 X:47726425-47726447 CCCTGACCACCACCAAGGAGTGG - Intergenic
1190891982 X:54577575-54577597 CCCTCACCACCTCCAGCCTCTGG + Intergenic
1191083663 X:56540410-56540432 CCCTCACCCCCAACAGGCCCCGG - Intergenic
1193401705 X:81053542-81053564 CCCTCACCCCCAGCAGGCCCTGG + Intergenic
1193894887 X:87100837-87100859 CCCTCACCACCACCGGTCTGTGG - Intergenic
1193947451 X:87755664-87755686 CCCGCACCCGAACCAGGCATTGG + Intergenic
1194539937 X:95157289-95157311 CACCCGCCACCACCAGGCTTGGG + Intergenic
1198070478 X:133143380-133143402 CCCTCACCAGAAGCAGACATTGG + Intergenic
1198728208 X:139699509-139699531 CCCACATCACCACCAGCCCTAGG + Intronic
1201021465 Y:9662231-9662253 CCCCCACCCCCAACAGGCACTGG - Intergenic
1201577690 Y:15478438-15478460 CCTTCACCTCCACAAGGCAGAGG - Intergenic
1201686349 Y:16707552-16707574 CCCTCAACCCCAACAGGCCTGGG - Intergenic
1202126783 Y:21575421-21575443 CCTCCACCCCTACCAGGCATTGG + Intergenic