ID: 1026972348

View in Genome Browser
Species Human (GRCh38)
Location 7:74476078-74476100
Sequence CCCCATCCCTCACCACCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 652
Summary {0: 1, 1: 0, 2: 6, 3: 57, 4: 588}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026972348_1026972353 2 Left 1026972348 7:74476078-74476100 CCTGGTGGTGGTGAGGGATGGGG 0: 1
1: 0
2: 6
3: 57
4: 588
Right 1026972353 7:74476103-74476125 GTGGCTATTTTGCAGTTGGATGG No data
1026972348_1026972352 -2 Left 1026972348 7:74476078-74476100 CCTGGTGGTGGTGAGGGATGGGG 0: 1
1: 0
2: 6
3: 57
4: 588
Right 1026972352 7:74476099-74476121 GGGTGTGGCTATTTTGCAGTTGG 0: 1
1: 0
2: 0
3: 13
4: 105
1026972348_1026972354 7 Left 1026972348 7:74476078-74476100 CCTGGTGGTGGTGAGGGATGGGG 0: 1
1: 0
2: 6
3: 57
4: 588
Right 1026972354 7:74476108-74476130 TATTTTGCAGTTGGATGGTGTGG 0: 1
1: 0
2: 0
3: 26
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026972348 Original CRISPR CCCCATCCCTCACCACCACC AGG (reversed) Intronic
900339496 1:2181279-2181301 CTCCAGCCCTCACCTCCCCCAGG + Intronic
900358966 1:2278851-2278873 CAACACCCCCCACCACCACCTGG - Intronic
900571608 1:3361394-3361416 CCCCCTCCCTCACAGCCAGCAGG + Intronic
900575799 1:3381957-3381979 CCCCCTCCCTCACCACTGGCCGG - Intronic
900635869 1:3664654-3664676 CCCCGTCCCCTACAACCACCAGG - Intronic
901013045 1:6211753-6211775 TCACAGCCCTCTCCACCACCTGG - Intronic
901191125 1:7410353-7410375 TCCCACCCCTCACCGTCACCTGG + Intronic
901262785 1:7885884-7885906 CCCACCCCCCCACCACCACCTGG - Intergenic
901960207 1:12820508-12820530 CCCAACCCCTCACAACCACTGGG - Intergenic
902242751 1:15099752-15099774 CCGCATCCCCCAGGACCACCAGG - Intronic
902317886 1:15637227-15637249 CCCCATCTCTCCCCACCAAAAGG - Intronic
902499669 1:16901523-16901545 CTTCTTCCATCACCACCACCTGG + Intronic
902640628 1:17764078-17764100 CCCCCACCCCCACCCCCACCGGG - Intronic
902966919 1:20011880-20011902 ACCCATTCCCCACCACCCCCTGG - Intergenic
902991017 1:20186882-20186904 CCCCAACCCACACCCCCACCAGG - Intronic
903017329 1:20369422-20369444 CTCCCTGCCTCACCCCCACCAGG + Intergenic
903535035 1:24061141-24061163 CATCACCCCTCACCTCCACCTGG - Intronic
903674510 1:25055587-25055609 CCTGAGCCCCCACCACCACCGGG + Intergenic
903889638 1:26560904-26560926 CACCATCCCTCCCCACCAGACGG - Intronic
904585268 1:31576574-31576596 CCCCAGCCCACACCTTCACCAGG + Exonic
904873735 1:33637503-33637525 CAGCATCCCTCACCATCAGCTGG + Intronic
904887690 1:33753578-33753600 CCCCTTCCCACAGCTCCACCAGG - Intronic
905026971 1:34857237-34857259 CCCCACCCCACCCCACCCCCCGG - Intronic
905408763 1:37754124-37754146 ACCCTGCCCTCACCACCACCTGG + Intronic
905484941 1:38288991-38289013 CCCCACACCCCACCACTACCAGG - Intergenic
905630217 1:39514391-39514413 CACTATCCCTCACCTCCATCAGG - Intronic
905774643 1:40660754-40660776 CCCCCTCCCTCCCTACCTCCCGG - Intronic
905806490 1:40881251-40881273 CCACATTCCTCTCCACCCCCAGG + Intergenic
906163951 1:43671885-43671907 CCCCACCCCACACCACTGCCTGG - Intronic
906196569 1:43933842-43933864 CCCCAGCCCTCGCTGCCACCCGG + Exonic
906199672 1:43951424-43951446 CCCCATCCATCACTTCCATCTGG - Intronic
907706528 1:56837376-56837398 CGCTTTCCCTCACCACCTCCAGG - Intergenic
908553383 1:65232621-65232643 CCCCATCCCTCACTATCTCAGGG - Intergenic
908836147 1:68231551-68231573 CCCCATCCCACCCAACCTCCCGG + Intronic
909003069 1:70242369-70242391 CCACACCCCACACCCCCACCAGG + Intronic
915115965 1:153599739-153599761 CCACCTCCTTCACCACCACAAGG + Intergenic
915942039 1:160124361-160124383 CTCCACCCTTCACCTCCACCAGG - Exonic
916048815 1:161020773-161020795 CCGCACCCCTCACGGCCACCAGG - Intronic
916079660 1:161224459-161224481 CCCCCTCCCCCACCCCCAACAGG - Intergenic
916484815 1:165249378-165249400 CCGCAGCCCTGCCCACCACCTGG + Intronic
916747461 1:167695345-167695367 CCCCAGCCCTCATGACCAGCAGG - Intronic
917024492 1:170627400-170627422 CCTCATCCCCCACCACCAAAAGG + Intergenic
917234634 1:172877788-172877810 CCCCATCCCTCAACAGTCCCGGG + Intergenic
918107838 1:181428586-181428608 CACCAACCATCACCACCACCTGG - Intronic
918137622 1:181688798-181688820 CCCCTTCCCACTCCAGCACCTGG + Intronic
919911374 1:202113058-202113080 CCCCATCCCACACAGCCACAAGG - Intergenic
920313600 1:205062442-205062464 CCCCAGCCAACACCTCCACCCGG - Exonic
920678345 1:208054323-208054345 CCCCACTCCCCTCCACCACCAGG - Intronic
921639446 1:217534635-217534657 CCTCTGCACTCACCACCACCCGG + Intronic
922343290 1:224674679-224674701 CCCTATCCCTACCCACCACTAGG - Intronic
922503138 1:226110957-226110979 GGCTACCCCTCACCACCACCTGG + Intergenic
922517881 1:226222285-226222307 CCCCACCCCTTACCACAGCCAGG + Intergenic
922572786 1:226643727-226643749 CTCCAGCCCTCATCACCTCCTGG - Intronic
922698345 1:227743189-227743211 CACCATCTCTCACCACCAGGAGG - Intronic
922718234 1:227887701-227887723 CGCCCGCCCTCATCACCACCTGG - Intergenic
922767574 1:228163861-228163883 CCTCATCCTCCACCATCACCTGG + Intergenic
922792401 1:228317573-228317595 CCCCCTCCTTCACCTCCACGCGG - Exonic
923228708 1:231963523-231963545 GCCCACCCCTCACCCTCACCAGG + Intronic
923546565 1:234927714-234927736 CACCAACCCTCAACACCATCAGG + Intergenic
923548195 1:234940152-234940174 CCACATCCCTCTCCAGCACCCGG + Intergenic
924599644 1:245477401-245477423 TCCTATCCCCCACCCCCACCAGG - Intronic
924653026 1:245948091-245948113 CCTCATCCTTCACCACCCTCGGG + Intronic
924709802 1:246522693-246522715 CCCATTCCATCACCACCTCCAGG + Intergenic
1062828521 10:588978-589000 CCTCTGTCCTCACCACCACCTGG + Intronic
1062933351 10:1367228-1367250 CCTCAGCTATCACCACCACCTGG + Intronic
1063197037 10:3753102-3753124 CCCCACTCCTCACCTCCACTTGG - Intergenic
1063458680 10:6202376-6202398 GCCCATCCCCCGCCACGACCCGG - Intronic
1063830821 10:9950610-9950632 CCCCAACCCTACCCACCAACAGG + Intergenic
1067043497 10:42970886-42970908 CCCCAGCCATACCCACCACCAGG + Intergenic
1067416628 10:46107575-46107597 CCCCCTCCCTCCCCTGCACCTGG - Intergenic
1069884873 10:71617372-71617394 CCTCATCCTTGTCCACCACCTGG - Intronic
1069915106 10:71782531-71782553 CCCCATCCCTCCACAACTCCTGG - Intronic
1070092600 10:73303002-73303024 CCCCACCGCCCCCCACCACCGGG + Intronic
1070274859 10:74996037-74996059 CCACCTCCCTCACCACCATCTGG - Intronic
1070695631 10:78561235-78561257 CCTCATCCCCCACCACCAGGAGG + Intergenic
1070834986 10:79442515-79442537 CCCCCTCCTGCACCACCCCCAGG - Intronic
1070957541 10:80474217-80474239 GCCAATCCTTCAACACCACCTGG - Intronic
1070972513 10:80579136-80579158 GCCCATCTCTCTCCATCACCAGG - Intronic
1071335719 10:84598851-84598873 CCCCAACATTCACCACCCCCAGG - Intergenic
1071554435 10:86591603-86591625 CCCAGCCCCTCACCACCTCCCGG - Intergenic
1071731587 10:88253791-88253813 CCCCCTCCCTCCCCTCCTCCTGG + Intergenic
1072249795 10:93572531-93572553 CCCCAACCCTTACCAAGACCAGG - Intronic
1072610067 10:97011876-97011898 CCCAATACCTCACCTCCTCCAGG + Intronic
1072781639 10:98255685-98255707 CCCCACTCATCACCACCTCCTGG + Exonic
1072840030 10:98762282-98762304 CCCCACCCCCCACCCCCGCCAGG - Intronic
1073153854 10:101330831-101330853 CCCTGACTCTCACCACCACCTGG + Intergenic
1074684630 10:115949540-115949562 CCCCCTCCCCCCACACCACCTGG + Intergenic
1075617899 10:123904870-123904892 CCCCATCCCACCCACCCACCTGG + Intronic
1075793003 10:125098905-125098927 CCCCCTCCATCCCCACCACTGGG + Intronic
1075932640 10:126312329-126312351 CTCCTTCCCTCTCCAACACCTGG + Intronic
1076216776 10:128701390-128701412 CCCCATCCTCCACCTCCACGTGG - Intergenic
1076286034 10:129297197-129297219 CCCCCTCCTTCAGCACCCCCTGG + Intergenic
1076457624 10:130611626-130611648 CCCATCCCCTCAACACCACCTGG - Intergenic
1076469756 10:130710187-130710209 CCCCCACCCTCAACCCCACCTGG - Intergenic
1076677418 10:132154300-132154322 CACCAGCCCACACCAACACCTGG - Intronic
1076718663 10:132382503-132382525 TCCCATCTCTTGCCACCACCTGG + Intergenic
1077008904 11:371380-371402 CCCCAGCCCTCTCCACTTCCTGG + Intronic
1077075117 11:697001-697023 CCCCCCCCACCACCACCACCGGG - Intronic
1077394165 11:2313015-2313037 CTCCACACCTCACCAACACCTGG - Intronic
1077579662 11:3408618-3408640 CCCCATCCCATGTCACCACCTGG - Intergenic
1078191687 11:9096433-9096455 CGCCATCCCTCATCACCCCTGGG + Intronic
1078329715 11:10409389-10409411 CCCCATCCCACTCCACCCCTCGG - Intronic
1078490151 11:11760857-11760879 CCGCCTCCCTCTCCACCCCCAGG + Intergenic
1080588333 11:33700499-33700521 CCCCCGCCCCCGCCACCACCCGG - Exonic
1081689085 11:45064167-45064189 CCCCTTCCCTTCCCACCATCAGG + Intergenic
1083226850 11:61290768-61290790 CCCCCTCCCCCACCACTCCCAGG + Intronic
1083579923 11:63818392-63818414 CCCAAACCCCCACCTCCACCGGG - Intronic
1083673714 11:64314119-64314141 TCCCAGGCCTCACCCCCACCTGG - Intronic
1083688260 11:64390786-64390808 CCACATCCCACACCACAGCCAGG - Intergenic
1083691114 11:64409533-64409555 CCCCCGCCCCCACCACCTCCGGG + Intergenic
1084005264 11:66319308-66319330 CCCCACCCCACACCGCCCCCTGG + Intergenic
1084083935 11:66846133-66846155 CCCCAGCCCTCCCCACCAAGGGG + Exonic
1084236677 11:67792139-67792161 CCCCATCCCAGGTCACCACCTGG - Intergenic
1084783787 11:71429868-71429890 CCCCACCCCTGACCACTTCCTGG + Intronic
1084835742 11:71800833-71800855 CCCCATCCCAGGTCACCACCTGG + Exonic
1085021606 11:73213564-73213586 CCCCAACCCTCATCACAACCAGG + Intergenic
1085037955 11:73310846-73310868 CCCAATTCCTCAGCGCCACCGGG + Exonic
1085465135 11:76717943-76717965 CCACATCCGTCACCACCTCCAGG + Intergenic
1085851417 11:80124592-80124614 CCCCATCCCACAGCTCCACTAGG - Intergenic
1086598208 11:88600312-88600334 CCCCTTCCCTCACCCTCCCCTGG + Intronic
1087797964 11:102474055-102474077 CCCCCACCCCCAACACCACCGGG - Intronic
1088878839 11:113957871-113957893 CCCCATCACTCTCCACCACCAGG - Intergenic
1089123370 11:116158481-116158503 TCCCTTCCTTCACCACCCCCAGG - Intergenic
1089498436 11:118919265-118919287 CCCCATCCCTCTCCTCCCCCAGG - Intronic
1089512578 11:119009496-119009518 CCCCATACCTCATCAGAACCTGG + Intronic
1089561883 11:119347209-119347231 CCCCAACCCTCCCCAAGACCTGG - Intergenic
1089978364 11:122752208-122752230 CCCCATCCCTCCCCATCCCTTGG + Intronic
1090048738 11:123358849-123358871 CCGGATCCCTCACCATCACTCGG - Intergenic
1090244991 11:125209861-125209883 CTCCCACCCTCACCTCCACCTGG + Intronic
1090272470 11:125397789-125397811 CCCCAGCCCCCACCACCCCAGGG - Intronic
1090406123 11:126476646-126476668 CCCCAGCCCCCACCCCCATCTGG - Intronic
1090451993 11:126814761-126814783 CCCCAACCCACACCCCCATCAGG - Intronic
1090704832 11:129326701-129326723 AACCATCCCCCACCACCCCCTGG - Intergenic
1091206314 11:133823640-133823662 CCCCCTCCTCCACAACCACCAGG + Intergenic
1091381498 12:64831-64853 GCCCACCCCCCACCACCACGTGG - Intergenic
1091445356 12:541847-541869 CCCCACCCCCCCCCACCCCCCGG + Intronic
1092098629 12:5864562-5864584 GCCTCTCCCTCACCCCCACCAGG + Intronic
1092236964 12:6816387-6816409 CCTCACCTCTCATCACCACCAGG - Exonic
1092834759 12:12477160-12477182 CCCCTTCCCTGACCAGCAGCTGG - Exonic
1093988955 12:25569007-25569029 CCCCTTCCCACAGCTCCACCAGG - Intronic
1094040144 12:26114056-26114078 CCCCACCCCCACCCACCACCTGG + Intergenic
1094046089 12:26168428-26168450 CCCCATCCCCCATCCCCAACCGG - Intronic
1094074464 12:26457621-26457643 CCACATCCTTCAATACCACCTGG - Intronic
1095085387 12:38053902-38053924 CCCCCTCCCCAACCTCCACCGGG - Intergenic
1096238385 12:49944999-49945021 CCTCAACCGTCACGACCACCTGG + Intergenic
1097174620 12:57135662-57135684 CCCTATCCCACAGCAGCACCGGG - Intronic
1098073385 12:66700092-66700114 CCCCAGCCCCCACCACAATCTGG - Intronic
1098439321 12:70501331-70501353 CCCCATCCCCCAACAGGACCTGG + Intergenic
1099890486 12:88583548-88583570 CCCCATCCCTCCTGTCCACCTGG - Intergenic
1100618605 12:96250319-96250341 CCACACCCCTGACTACCACCCGG - Intronic
1101265092 12:103076066-103076088 CCCCATCCCCCAACAGGACCCGG - Intergenic
1101431772 12:104632915-104632937 CACCTTCCCTCACCCCCTCCAGG - Intronic
1102453711 12:113058261-113058283 GCCACTCCCACACCACCACCCGG - Exonic
1102561046 12:113762531-113762553 CCCCCTCCCTCCCCACCCCCAGG + Intergenic
1103443519 12:120979943-120979965 CCCCATCCCCCACCCCCACTAGG - Intronic
1103930912 12:124450318-124450340 CCCCAGACCTCACCAACACTTGG - Intronic
1104271982 12:127290457-127290479 CCCCATCTCTGACCCTCACCAGG + Intergenic
1104890569 12:132137878-132137900 CCCCAACCCCCACCAACTCCCGG + Exonic
1105022960 12:132829230-132829252 CCCAACCCCGCACCTCCACCCGG + Intronic
1105851521 13:24340185-24340207 CCCCTTCCCTCAGCAGCTCCCGG - Intergenic
1106180168 13:27363076-27363098 CGCCATCCCCCACCAACCCCAGG + Intergenic
1106476334 13:30101645-30101667 CTCCACCCCCCACCACCTCCGGG + Intergenic
1107963368 13:45578161-45578183 CTTCATCCTCCACCACCACCTGG + Intronic
1109342265 13:61076507-61076529 CCCCTTCTCACAGCACCACCAGG - Intergenic
1112076011 13:95914084-95914106 CCCCATCCCTCAACAGGCCCTGG - Intronic
1112326340 13:98444881-98444903 GCCCAGCCCTGGCCACCACCAGG + Intronic
1112388250 13:98959938-98959960 CTCCATGCCCCACCAGCACCTGG - Intronic
1114028158 14:18548816-18548838 CCTCATCCCCCAACAGCACCTGG + Intergenic
1114879312 14:26764181-26764203 CCCCATCCCTCCCCATAATCTGG + Intergenic
1115050526 14:29055757-29055779 CCCCACCCCTCCCCAGCATCTGG + Intergenic
1115465242 14:33707907-33707929 TACCTTCCCTCACCACCCCCCGG - Intronic
1117019630 14:51556581-51556603 TCGCCTCCCTCCCCACCACCAGG - Intronic
1117816971 14:59608688-59608710 CCCCACCCACCACCACTACCTGG + Intronic
1118389808 14:65286766-65286788 CGCCCTCCCTCCCCATCACCTGG - Intergenic
1118988933 14:70780635-70780657 CTCCATCCCTCACCTCATCCAGG + Intronic
1119862812 14:77948799-77948821 CTCCTTCCCTCCCCACTACCTGG + Intergenic
1120638474 14:86980713-86980735 ACCCATCACCCACCACCAACAGG - Intergenic
1120876373 14:89379734-89379756 CGCCCTCCCTCCCCACCACCAGG + Intronic
1121327405 14:93029284-93029306 GCCCGCCCCTCACCTCCACCTGG + Intronic
1122364417 14:101186070-101186092 CCCCATCCCTGAGCAGCTCCCGG + Intergenic
1122635916 14:103129606-103129628 CACCCTCCCGCACCCCCACCCGG - Intronic
1122812285 14:104295064-104295086 CCCCACCCATCCCCACCACAGGG - Intergenic
1122828439 14:104383578-104383600 CCCCAGCCCCCACCTGCACCGGG + Intergenic
1122930620 14:104931640-104931662 CCCCCTCCCTCCACACCACATGG + Intronic
1122930713 14:104931990-104932012 CCCCGTCCCTCCCCACCCCAAGG + Exonic
1122939143 14:104973496-104973518 CCCCATGACTCACCCCCACCAGG - Intronic
1122986134 14:105212535-105212557 CCCCAACCCTCACCAGGCCCAGG + Intronic
1202858429 14_GL000225v1_random:65185-65207 CCCCAAACCCCACCACCCCCCGG - Intergenic
1124876910 15:33603280-33603302 CCCCATCCTTCTCCACCTCCTGG - Exonic
1125470192 15:39994760-39994782 CCCTAACCCTCACCCTCACCAGG - Intronic
1125760675 15:42093797-42093819 CCTCATTCCTGGCCACCACCTGG + Intronic
1126369682 15:47932699-47932721 CCCCATCCCCCACCCCCATAGGG - Intergenic
1126697933 15:51341547-51341569 CCCCATCCCGCCCCGCCAGCTGG + Intergenic
1127256109 15:57295150-57295172 CCCCACCTCTCGCCACCCCCAGG - Intronic
1127397160 15:58552159-58552181 CCCCTTCCCTCCTCTCCACCCGG - Intronic
1127863251 15:63011806-63011828 AACCATCCCTAACCACCACTGGG - Intergenic
1128146247 15:65333982-65334004 GCCCTTCCCCCACCCCCACCAGG + Intronic
1128889978 15:71322807-71322829 CACCATGCCTGGCCACCACCTGG - Intronic
1129066180 15:72906146-72906168 CCCAGTGCCTCTCCACCACCAGG + Intergenic
1129249901 15:74303066-74303088 CTCCACTCCTCAGCACCACCTGG + Intronic
1129800173 15:78407825-78407847 CCTCATTTCTCAGCACCACCAGG + Intergenic
1129844367 15:78761486-78761508 CACCTTCCCTGAGCACCACCTGG + Intronic
1130107934 15:80942983-80943005 TCCCGTCAATCACCACCACCTGG - Exonic
1130257433 15:82332293-82332315 CGCCTTCCCTGAGCACCACCTGG - Intergenic
1130322237 15:82850857-82850879 CCCCGCTCCTCACCCCCACCAGG + Intronic
1130553278 15:84905460-84905482 CCCCTGCTCTCACCCCCACCCGG + Intronic
1130597512 15:85257672-85257694 CGCCTTCCCTGAGCACCACCTGG + Intergenic
1130975722 15:88772673-88772695 CACCAACCCTCAGCCCCACCTGG - Intergenic
1131035921 15:89221928-89221950 CCCCCCCCACCACCACCACCAGG + Intergenic
1131123415 15:89837686-89837708 TCCCACCCATCACCACCTCCTGG + Exonic
1131168367 15:90159148-90159170 CCTCATGCCTCACCAACTCCAGG + Intergenic
1132403459 15:101527977-101527999 CCCCACCCCTCGCCCCCATCTGG - Intergenic
1132666411 16:1083107-1083129 CCGCACCCCCCACCCCCACCGGG - Intergenic
1132687531 16:1168553-1168575 CCCCACCTGTCACCACCTCCAGG - Intronic
1132718457 16:1303987-1304009 ACCCATCCCTCACCCCAATCTGG + Intergenic
1132899129 16:2243950-2243972 CACCAGCCCTCCCCTCCACCAGG + Intronic
1132951001 16:2562440-2562462 CCCCGTCTCTCCCCAGCACCCGG + Intronic
1132963348 16:2637730-2637752 CCCCGTCTCTCCCCAGCACCCGG - Intergenic
1133323639 16:4930416-4930438 CCCCATTCATCCCCACCTCCGGG + Intronic
1133348287 16:5084682-5084704 CCCCATCCCAGGTCACCACCTGG - Exonic
1133718395 16:8471106-8471128 CCCACTACCTCCCCACCACCAGG + Intergenic
1134093653 16:11404773-11404795 GGCCATCCCACAGCACCACCTGG + Exonic
1134256746 16:12618700-12618722 CCCATCCCCCCACCACCACCAGG + Intergenic
1134441497 16:14302042-14302064 CCCCCACCCCCACCCCCACCCGG + Intergenic
1136097623 16:27968691-27968713 TCCCAGCTCTCACCACCAACTGG + Intronic
1136398579 16:30005858-30005880 CCCCGTCCCTCTCCCCCAACAGG - Exonic
1136537798 16:30910559-30910581 CCCCCTCCCTCCCAGCCACCAGG - Intergenic
1137678143 16:50314413-50314435 CCCCACCCCGCTCCATCACCCGG - Intronic
1138389939 16:56662963-56662985 CCCCCTCCCCCACCCCCACGCGG + Intronic
1138483372 16:57318743-57318765 CCCCATCCCCCACCCACCCCAGG - Intergenic
1138563605 16:57816661-57816683 CTCCACCCCTCCCCACAACCAGG + Intronic
1139846442 16:69924806-69924828 CCCAAGCCCTCACCTCCCCCAGG - Intronic
1140321115 16:73952432-73952454 TCCCAACCCTCCCCACCCCCGGG + Intergenic
1141648081 16:85378085-85378107 CCCCATCCCCCGCCACCACCCGG + Intergenic
1141755434 16:85987753-85987775 CCCCCCCCCCCACCACCCCCCGG + Intergenic
1141926652 16:87174341-87174363 CCCCATCCCCTGCCTCCACCTGG + Intronic
1142265486 16:89062356-89062378 CCCAGACCCCCACCACCACCAGG - Intergenic
1142325457 16:89411952-89411974 CCCCATCCCTCCCCTCAGCCAGG + Intronic
1142325475 16:89412013-89412035 CCCCATCCCTCCCCTCAGCCAGG + Intronic
1142325509 16:89412135-89412157 CCCCATCCCTCCCCTCAGCCAGG + Intronic
1142325527 16:89412196-89412218 CCCCATCCCTCCCCTCAGCCAGG + Intronic
1142325545 16:89412257-89412279 CCCCATCCCTCCCCTCAGCCAGG + Intronic
1142325563 16:89412318-89412340 CCCCATCCCTCCCCTCAGCCAGG + Intronic
1142325581 16:89412379-89412401 CCCCATCCCTCCCCTCAGCCAGG + Intronic
1142352484 16:89586549-89586571 CCCCTCCCCTCCCCACCACGGGG + Intronic
1142525306 17:536053-536075 CACTGACCCTCACCACCACCTGG + Intronic
1142708579 17:1710912-1710934 CCCCCTCCCCCACAACCCCCAGG + Intergenic
1143015367 17:3888720-3888742 CCCCATCCCTCCCTCCCGCCTGG + Intronic
1143583192 17:7838287-7838309 CTCCCTCCCTCCCCACCAGCAGG - Intergenic
1143628032 17:8122078-8122100 CCCCTTCCCTCACCCCTGCCGGG - Intronic
1143645246 17:8225712-8225734 CTCCATCCCTCTCCACCAGCGGG - Intergenic
1143718007 17:8789097-8789119 CCCCAACCCTCCACACCACTAGG + Intergenic
1143766773 17:9143059-9143081 CTTCATCCCTCATCACCTCCAGG - Intronic
1145207598 17:20992841-20992863 CCCCCTCCCTCTCCCCCGCCAGG + Intergenic
1145230889 17:21172433-21172455 CCCCACCCCACCCCACCCCCGGG - Intronic
1145234721 17:21200522-21200544 CCCCTTCCCTCAGCACACCCTGG + Intronic
1146946685 17:36878155-36878177 CCCCACCCCTGCCCACCAACGGG - Intergenic
1146966665 17:37037157-37037179 CACCACCCCTCCCCACCCCCTGG + Intronic
1147019561 17:37520712-37520734 CCTCATCACTCACCCCCAGCAGG + Intronic
1147327291 17:39675541-39675563 GCGCATCCCTCCCCACCTCCAGG - Intronic
1147412622 17:40264702-40264724 GCCCCTCCCCCACCACCCCCAGG + Exonic
1147649802 17:42055388-42055410 CCCCCTCCCCCAGGACCACCAGG - Intronic
1148052013 17:44774221-44774243 CCCAAGGCCCCACCACCACCCGG + Intronic
1148352347 17:46950219-46950241 TCCTATCCCTCACCCCCAGCTGG + Intronic
1148749368 17:49935702-49935724 CCCCACCCCACGCCTCCACCCGG - Intergenic
1149364676 17:55931114-55931136 CCCCATACCTCAGCATCACATGG + Intergenic
1149427426 17:56568878-56568900 CCCCATACCTCACCTCCATGAGG + Intergenic
1149439774 17:56664394-56664416 CCCCACCCATCCCCACCTCCTGG - Intergenic
1149645774 17:58240561-58240583 ACCCGTCCCTCACACCCACCAGG + Intronic
1150140026 17:62720295-62720317 CCCCACACCTCACCACCACATGG - Intronic
1150223308 17:63509252-63509274 GCCCATCCCTGCCCACCTCCTGG + Intronic
1150280968 17:63929475-63929497 CTCCATCCCTCTCCGCCCCCAGG - Exonic
1150317110 17:64178274-64178296 CTCCATCCCTGACCCCCTCCAGG - Intronic
1151187793 17:72376517-72376539 TCCCATTCCTCACAACCACCAGG + Intergenic
1151745453 17:76009421-76009443 TCTCATGCCTCACCACCTCCTGG + Exonic
1151795456 17:76342069-76342091 CCCCTTCCCTCAATACCACAGGG + Intronic
1151983126 17:77526132-77526154 CCCCACCCCCCACCCCCTCCTGG - Intergenic
1152234370 17:79130782-79130804 CCCCATCCCGCACCAAGCCCGGG - Intronic
1152243673 17:79173910-79173932 CCCCACCCCCCACCCCCAGCAGG - Intronic
1152467184 17:80473055-80473077 CCCCCTCCCTCAGTCCCACCTGG + Intronic
1152666164 17:81570822-81570844 CCCCATGCCTCACTTCCACAGGG + Intronic
1153198953 18:2630152-2630174 CCCCAACCCTCACCATTACCTGG + Intergenic
1153711839 18:7808068-7808090 ATCCATCGCTCACAACCACCAGG - Intronic
1153713818 18:7825493-7825515 CTCCATCCCTCACAAACACCTGG - Intronic
1154390308 18:13931285-13931307 CAGCATGCCTCACCCCCACCTGG + Intergenic
1155050855 18:22146557-22146579 CCCCATCCCCAACCACTACGGGG - Intergenic
1156497839 18:37537674-37537696 CTCCATCTGTCACCACCTCCGGG - Intronic
1158437200 18:57441963-57441985 CCCCACCCCTTCCCACCCCCTGG + Intronic
1160005206 18:75064030-75064052 CCTCTTCGCTCACCACCACCTGG - Exonic
1160694798 19:478276-478298 CCCCATCCCTCCTCACATCCGGG + Intergenic
1160891586 19:1381471-1381493 CCCCATCCCCCACCACCACTAGG + Intergenic
1160952622 19:1674881-1674903 CCCCAGCCCTGACCACTGCCTGG - Intergenic
1161078856 19:2300576-2300598 CCCCATCCCTGACCTCTCCCAGG + Intronic
1161111952 19:2475657-2475679 CTCCGGCCCTCACCACCACCTGG + Intergenic
1161209993 19:3061469-3061491 CCCCGTCCCCCGCCACCCCCAGG + Intronic
1161253853 19:3295540-3295562 CCCCCACCCCCACCACCTCCTGG + Intronic
1161362159 19:3856558-3856580 CTCCATCCCTCCCCAGCCCCCGG + Intronic
1161488008 19:4546165-4546187 CCCCATCCCCCACTACCATGGGG - Intronic
1161571892 19:5035423-5035445 CCTCATCCCTCACCTCCCACCGG + Intronic
1162345434 19:10115584-10115606 CCCCATCCCGCCCCTCCACAGGG - Exonic
1163289528 19:16370375-16370397 CCCCAGCCCTCACCTCCCTCAGG + Intronic
1163520272 19:17787906-17787928 CCCAATCCCTCCCCACACCCCGG - Intronic
1163529872 19:17842866-17842888 ACCCAGCCCTCTCCACCCCCAGG - Intronic
1163633348 19:18427804-18427826 GCCCAGCCCGTACCACCACCAGG - Exonic
1164452693 19:28380654-28380676 CCCTGTCCCCCACCGCCACCTGG - Intergenic
1164476838 19:28582041-28582063 CCCCCGCCCTCACCACCCCCAGG + Intergenic
1165435446 19:35792484-35792506 CCTGATCCCTCACTCCCACCAGG + Intergenic
1165714786 19:38037331-38037353 CCCCATTCCTCGCCCCCACTGGG - Intronic
1165907973 19:39205060-39205082 CCCCACCCCCCACCCCCACCAGG + Intergenic
1166124426 19:40705259-40705281 CCCCAGCCCTACCCACCAACAGG - Intronic
1166220278 19:41359908-41359930 CCCCCTCCCTCATCACCCTCTGG + Intronic
1166739149 19:45103707-45103729 TCACCTCCATCACCACCACCAGG - Intronic
1166981433 19:46634399-46634421 CCCCATCCCTCCCCTCGTCCTGG + Intronic
1167616256 19:50535856-50535878 TCCCACCCTTCCCCACCACCAGG + Intronic
1167640051 19:50676365-50676387 CCCCCTCCTTCACCTCCTCCAGG - Intronic
1168074579 19:53972916-53972938 CCCCATCACTCACCCCCAATAGG + Intronic
1168287715 19:55342720-55342742 CCCCCACCCTCACCCTCACCAGG + Exonic
925154568 2:1639621-1639643 CCCCAGCCCTCATGACCTCCTGG + Intronic
925182497 2:1826350-1826372 CCCCAGCCCTCCCCAGGACCTGG - Intronic
925738976 2:6988582-6988604 CCACACCCCTCACCCCCACCAGG - Intronic
926141597 2:10371417-10371439 CCCCACCCCACCCCACCCCCTGG - Intronic
926151074 2:10425852-10425874 CCTCATCCTTCCCCACCAGCTGG + Intronic
926364025 2:12116375-12116397 GCCCATCCGTGACCACCTCCAGG - Intergenic
926787657 2:16534218-16534240 CCCCATGCCTCATCAACATCAGG + Intergenic
926931025 2:18040941-18040963 CCTCATCCTCCACCCCCACCGGG - Intronic
928092971 2:28387340-28387362 CCCCCTCCCCCACCCCCACCAGG + Intergenic
928270914 2:29853839-29853861 CCACGTCCCTCCCCACCTCCTGG + Intronic
928515334 2:32039574-32039596 CCCCGCCCCTCACCCCCACCTGG + Intronic
928835828 2:35543480-35543502 CCACATTCCTCACCAGCATCTGG - Intergenic
929675152 2:43919239-43919261 CCCCATCCCCCACCACAACCTGG + Intronic
929718413 2:44337965-44337987 CCCCATCCCACATCCCCAACAGG - Intronic
929868465 2:45737762-45737784 GGCCCTCCCTCACCTCCACCTGG + Intronic
932137216 2:69242047-69242069 TCCCCTCACTCCCCACCACCTGG - Intronic
932281090 2:70492446-70492468 CCCCATTTCTCACCATCGCCAGG + Intronic
932411771 2:71551711-71551733 CCACACCCCTCACCTCCACCCGG - Exonic
932446212 2:71783071-71783093 CCCCAGCCCTTGCCACCAGCAGG + Intergenic
932515946 2:72349449-72349471 CCCCATCCCTGACCTCCAGGAGG + Intronic
932841729 2:75089325-75089347 CCCCTGCCCTCACCTCCTCCAGG + Intronic
933776101 2:85772167-85772189 ACCCACCCCTCGCTACCACCAGG - Intronic
934033240 2:88066459-88066481 CCCCACCCCCAACCCCCACCAGG + Intergenic
934653987 2:96107909-96107931 CTCCATCCCCCAACCCCACCTGG - Intergenic
935057114 2:99577269-99577291 CTCCATCCCTAACTGCCACCCGG - Intronic
935373153 2:102368465-102368487 CCCCATCCCTGCTCCCCACCAGG - Intronic
936258123 2:110934792-110934814 CCCCACCCCCCACCATCATCAGG - Intronic
936373617 2:111922736-111922758 CCCAGTCCCTCACCACCTCAAGG - Intronic
937296616 2:120813334-120813356 CGCCATCCCCCACCTCCTCCGGG - Intronic
937377539 2:121347942-121347964 CCCCACCCCCCACCCCAACCTGG + Intronic
937460320 2:122079782-122079804 CTCGGTCCCTCACCTCCACCTGG + Intergenic
937869733 2:126778457-126778479 CCTTATTCCCCACCACCACCAGG + Intergenic
938063518 2:128269329-128269351 CCCCCCCCCCAACCACCACCAGG - Intronic
938297682 2:130188643-130188665 CTGTAACCCTCACCACCACCAGG + Intronic
938459088 2:131486023-131486045 CTGTAACCCTCACCACCACCAGG - Intronic
939019286 2:136939874-136939896 CCCCGACACACACCACCACCAGG + Intronic
939901855 2:147860170-147860192 CTTCATTCCTCACCACCAGCTGG + Intronic
940329681 2:152460980-152461002 CCCCTTGCCTCCCCACTACCTGG + Intronic
940789638 2:158018580-158018602 CCCCTTCCCCCACTGCCACCTGG - Intronic
941966050 2:171302330-171302352 CCCAACCCCCCACCACCCCCAGG - Intergenic
942349500 2:175038180-175038202 CCTCTGCCCTCACCACCACTGGG + Intergenic
942587467 2:177498329-177498351 GCACACCCCCCACCACCACCTGG - Intronic
942657746 2:178231607-178231629 CCCCCATCCTGACCACCACCAGG + Intronic
942881948 2:180871695-180871717 CCTCCTTCGTCACCACCACCTGG - Intergenic
943451127 2:188043729-188043751 CCTCACCCCTCACCCCCAACAGG - Intergenic
944579666 2:201120986-201121008 CCCCATTCCTCAGCCCCAGCAGG - Intronic
944632200 2:201638813-201638835 CCCTGTACCTCACCACCACCAGG + Intronic
946051881 2:216869629-216869651 CCCCATCCCCAACCCCAACCTGG + Intergenic
946055801 2:216901023-216901045 CCCCTTCCCTCAGCTCCACGAGG + Intergenic
946419990 2:219559327-219559349 GCCCATCCCTCTCCAGCACCAGG + Exonic
946640701 2:221780622-221780644 CCCCTTCCCTCACCAAGGCCAGG - Intergenic
946676815 2:222169167-222169189 TCCCATCACTCACTGCCACCTGG - Intergenic
947193358 2:227534841-227534863 CCACTTCCCTGATCACCACCTGG - Exonic
947492767 2:230610285-230610307 CCCCACCCCTCTCCACCATGAGG + Intergenic
947566358 2:231196454-231196476 CCCCATCCCTCACCACAGGATGG - Intergenic
948607250 2:239143950-239143972 ACCCATTCCCAACCACCACCAGG - Intronic
948835436 2:240624001-240624023 CCCCCACCCCCCCCACCACCAGG - Intronic
1169315638 20:4588332-4588354 CCCCACCCCTCTGCACCCCCAGG + Intergenic
1169343078 20:4810758-4810780 CTCCCTCCCTCACCCCCACTGGG - Intronic
1170484783 20:16805415-16805437 CCCCCTCCCTCTCCTCCTCCTGG + Intergenic
1170520447 20:17179763-17179785 CCACAGCCCCCACCACCACACGG + Intergenic
1171351690 20:24507507-24507529 GCCCATCCCTCTCCAGCTCCAGG + Intronic
1172125861 20:32624853-32624875 ACCCACCCCTTACCACCCCCTGG + Intergenic
1172273247 20:33666479-33666501 CCCCTCCCCTCTCCACAACCAGG + Exonic
1172437106 20:34937092-34937114 CCCCATACCGCCCCACCTCCTGG + Intronic
1172590387 20:36113565-36113587 CCCCTACCCCCACCACCCCCAGG - Intronic
1172753486 20:37267699-37267721 TCCCAGCCCTCCCCGCCACCAGG - Intergenic
1172838244 20:37886658-37886680 CCTCATCCCTCGCCTCCACCCGG - Intergenic
1173613584 20:44388496-44388518 CCCCATCACACACCAGCACATGG - Intronic
1174106293 20:48164808-48164830 CCCCGGTCCTCATCACCACCTGG + Intergenic
1174214098 20:48902984-48903006 CCCCCCCCCCCACCATCACCTGG - Intergenic
1174379594 20:50148169-50148191 CAGCACCCCTCACCACCTCCTGG + Intronic
1174445095 20:50585566-50585588 AACCATCCCTCACCACCCCCAGG - Intergenic
1175171188 20:57082586-57082608 CCGTGGCCCTCACCACCACCTGG - Intergenic
1175259237 20:57664268-57664290 CCCCACCCCACACCACCCCAGGG + Intronic
1175401273 20:58701239-58701261 CCCCACCCCACCCCACCCCCAGG - Intronic
1175522274 20:59609481-59609503 CCCCCACCCTCACCCCCACCAGG + Intronic
1175603542 20:60294526-60294548 CCTCATGCCACACCACGACCTGG + Intergenic
1176013777 20:62917100-62917122 CCCCCACCCACACCACCGCCAGG + Intronic
1176283709 20:64330003-64330025 GCCCACCCCCCACCACCACGTGG + Intergenic
1178711677 21:34922680-34922702 CCCCAGGCCTCACCACCAGGGGG - Intronic
1179004065 21:37494394-37494416 CCAGTTCTCTCACCACCACCTGG + Intronic
1179938193 21:44618583-44618605 CCCCATCCCCCATCCCCAGCTGG + Intronic
1180452280 22:15475869-15475891 CCTCATCCCCCAACAGCACCTGG + Intergenic
1180517347 22:16158290-16158312 CCCCCACCCCCACCCCCACCCGG + Intergenic
1180868499 22:19133285-19133307 CCCCCTCCCTCCCCACTTCCTGG + Exonic
1181031433 22:20150328-20150350 CCCCAGCCCCACCCACCACCTGG - Intronic
1181031456 22:20150377-20150399 CCCCAGCCCCACCCACCACCTGG - Intronic
1181047757 22:20223661-20223683 CCCCATCCCTGACCTGCCCCAGG - Intergenic
1182144642 22:27989998-27990020 CCCCCTTCCTCAGCTCCACCAGG - Exonic
1182664117 22:31944860-31944882 CCCCGTCCCTCCCCAACGCCAGG - Intronic
1182718399 22:32378043-32378065 CCACAACCCTCCCCGCCACCTGG - Intronic
1183582551 22:38734567-38734589 TCCCATCCCCCACCACAACTGGG + Intronic
1184152277 22:42646112-42646134 CCCCAACCCTCACCAGCAGTGGG + Intronic
1184403311 22:44286292-44286314 CCCCTTCACTCAACACGACCAGG + Intronic
1184800309 22:46754918-46754940 CCCCCTCCCTCCCCACCGCTGGG + Intergenic
1184904260 22:47469554-47469576 CCCCCTCCTCCTCCACCACCAGG + Intronic
1184959048 22:47915526-47915548 CTCCATCCCTCAATAGCACCGGG - Intergenic
1185210788 22:49569492-49569514 CCCCAGCCCTGGCCAACACCTGG - Intronic
1185333168 22:50260686-50260708 CCTCCTCCCCCTCCACCACCGGG + Intronic
1185419747 22:50728781-50728803 CTCCAGCAGTCACCACCACCTGG + Intergenic
949877733 3:8637451-8637473 CCTCATCCCACACTCCCACCTGG + Intronic
950701861 3:14756279-14756301 CCACAACCCTCACAACAACCCGG + Intronic
950863652 3:16172014-16172036 TCCCATCCCCCACCATCACTTGG - Intergenic
952819478 3:37473471-37473493 CCCCTTCCCACAGCACCCCCAGG - Intronic
952960642 3:38587229-38587251 CCCCCTACCTCACCAGCACTGGG + Intronic
952963787 3:38608753-38608775 CCCCAACACTCACCATTACCTGG + Intronic
953386883 3:42511680-42511702 CCCCATCTCCCACCAGCAACAGG - Intronic
953606587 3:44416734-44416756 GCCCCTCCCTGGCCACCACCAGG + Intergenic
954277551 3:49552528-49552550 CCACATCCCAGACCATCACCAGG + Intergenic
954368185 3:50156945-50156967 CCCCATCCCCCAACACCTCAAGG - Intronic
954386430 3:50246367-50246389 ACCCATGCCCCGCCACCACCAGG - Intronic
954390415 3:50265454-50265476 CCCCACCCCTGGCCACCAGCTGG - Intergenic
954636103 3:52071682-52071704 CCCAATCCCTTCTCACCACCGGG + Intergenic
954837982 3:53487382-53487404 CGCCATACCCCACCACCATCAGG - Intergenic
955065302 3:55528877-55528899 CCATATCCCTCCCCACCCCCAGG - Intronic
955227659 3:57074341-57074363 TTCCATCCCCCACCCCCACCAGG + Exonic
955972054 3:64445625-64445647 TCCCATCCCTCCCCCGCACCCGG + Intergenic
957052634 3:75421944-75421966 CCCCATCCCAGGTCACCACCTGG - Intergenic
958897572 3:99846153-99846175 CCCCGTCCCCCACCAGCACTTGG + Intronic
958979849 3:100708673-100708695 CCTCATCCTCCACCACCCCCAGG + Intergenic
959431126 3:106256478-106256500 CCCCATCCCTCTCCACTCCTGGG + Intergenic
960394607 3:117120949-117120971 CCCCATCTCTCAGAACCAACAGG - Intronic
960573178 3:119205509-119205531 CCCCATCCCATGCCCCCACCGGG + Intergenic
961302212 3:125929613-125929635 CCCCATCCCAGGTCACCACCTGG + Intronic
961366351 3:126402200-126402222 TCCCATCCCTCACCACCCCCAGG - Intronic
961450799 3:127001460-127001482 CCCCCTCCCCTACCAGCACCAGG - Intronic
961657716 3:128452564-128452586 CCCCATGCCTCACAAGCACTTGG - Intergenic
961660651 3:128467184-128467206 CCACCACCATCACCACCACCGGG - Intronic
961826465 3:129601759-129601781 TCCCATCACTCCCCACCACTGGG + Intronic
961886246 3:130098165-130098187 CCCCATCCCAGGTCACCACCTGG - Intronic
962494636 3:135926852-135926874 TTCCATCCCTCCACACCACCTGG + Intergenic
962630351 3:137269549-137269571 CCACCCCCATCACCACCACCAGG - Intergenic
963085777 3:141435016-141435038 CCCCATCCCTCAACAGTAGCTGG - Intronic
963727202 3:148936040-148936062 CCACATTCCTCACCTCCTCCAGG - Intergenic
963867694 3:150379871-150379893 ACCCCCACCTCACCACCACCTGG + Intergenic
963948367 3:151170853-151170875 CCTCAACCCCCACCACCTCCAGG - Intronic
964443776 3:156739507-156739529 CACCATCCCACTCCAACACCTGG - Intergenic
965125106 3:164617505-164617527 CCCCCACTCTCACCACCACAAGG + Intergenic
966629528 3:182057075-182057097 CCCCACCCCACACACCCACCTGG + Intergenic
967266482 3:187696436-187696458 CCCCTTCTCTCACCATCGCCAGG + Intergenic
967967461 3:194973466-194973488 CCCCATCCCACCCCACCCACAGG + Intergenic
967990307 3:195125502-195125524 CCCCATTGCCCACCCCCACCAGG - Intronic
968469146 4:770300-770322 CCCCAGCCCTCCCCACTCCCAGG + Exonic
968715942 4:2159724-2159746 CCCCAGAGCTAACCACCACCTGG + Intronic
968728147 4:2257726-2257748 CCACATCTCTCACCCCCACCTGG + Intronic
969428892 4:7141438-7141460 CCACAGCCCTCCCCACCCCCTGG - Intergenic
969675388 4:8611547-8611569 CCCCACCCCACTCCACCTCCAGG - Intronic
969758553 4:9166474-9166496 CCCCATCCCAGGTCACCACCTGG + Intergenic
969818517 4:9703924-9703946 CCCCATCCCAGGTCACCACCTGG + Intergenic
970007786 4:11427783-11427805 CCCCATCCCGCGCCGGCACCCGG + Intronic
971388374 4:26162143-26162165 CCCCATCCCACTTCACCACTGGG - Intergenic
971520050 4:27538265-27538287 CCCTCTCCCTAACCTCCACCTGG + Intergenic
971586957 4:28416410-28416432 CCCCATCCCTACCCCACACCTGG + Intergenic
973093766 4:46171502-46171524 CTCCCTCCCTCCCCACCAACTGG + Intergenic
974418259 4:61639038-61639060 CCACATCCCTCAACAAAACCTGG + Intronic
975379461 4:73681532-73681554 CCCCTACCCCCACCACCCCCAGG - Intergenic
978577186 4:110199051-110199073 CCCCTACCCCCACCCCCACCCGG + Intronic
978848279 4:113301638-113301660 CCCCTTCCTTCTCCAACACCTGG + Intronic
979529589 4:121755030-121755052 CCTCATCCCCCACCTCCAACTGG - Intergenic
979656885 4:123205671-123205693 TCCCCTCCCTAACCCCCACCAGG - Intronic
980613995 4:135194663-135194685 CCCCATCCCACAGCACCACTAGG - Intergenic
983370571 4:166852429-166852451 CTCCATCCCTAACCACCATTAGG + Intronic
984253320 4:177360590-177360612 CCCCATCCTTCCCCACAACTCGG - Exonic
985541270 5:488771-488793 CCCCATCCCTCCCCAGCATGCGG - Intronic
985664672 5:1175862-1175884 CCCCCTCCCTCAGCAGCAGCAGG - Intergenic
985750707 5:1672641-1672663 ACCCATCACTCCCCTCCACCAGG - Intergenic
985977257 5:3430074-3430096 CCCCATCCCCCACACGCACCTGG - Intergenic
986015674 5:3754915-3754937 CCCCAGCCCTGGGCACCACCAGG + Intergenic
986790628 5:11156010-11156032 CCCCATTCCCTACCACCTCCAGG - Intronic
987142775 5:14962410-14962432 CCCCAACCGTCAGCATCACCTGG - Intergenic
987179728 5:15354922-15354944 CCCCCTTCCTCACCACCACAGGG + Intergenic
987752357 5:22057516-22057538 CCCCATCCCTCACCCCCGGGAGG - Intronic
989035169 5:37163207-37163229 CCCCATCCCTCACCATTACTAGG - Intronic
989302549 5:39911081-39911103 CCCCATCCCACAACAGGACCCGG - Intergenic
992529693 5:77642372-77642394 CCCCATCCCACCCCACCTCCCGG - Intergenic
992950157 5:81850713-81850735 GGCCTTCCCTCTCCACCACCAGG - Intergenic
995226050 5:109702378-109702400 CTCTCTCCCTCTCCACCACCGGG - Intronic
996204467 5:120714981-120715003 CCTCACCCCCCACCACCAACAGG - Intergenic
997470198 5:134113300-134113322 CCCCCTCCCCCGCCACCTCCGGG - Intergenic
998099397 5:139419456-139419478 CCCCTACCCTCACCTCCAGCTGG - Intronic
998172084 5:139878396-139878418 CCCCATCCCAGCCCACCACCCGG - Intronic
998203214 5:140141770-140141792 CCCCATCCCTCCCCCTCCCCTGG - Intergenic
998696322 5:144643935-144643957 CCCCACCCCTCACCAGGTCCTGG + Intergenic
999074408 5:148780879-148780901 TCCCATCCCTCACCACCAGGGGG + Intergenic
1000144332 5:158438950-158438972 CCCCATCCCTCAACAGGCCCTGG + Intergenic
1000304514 5:159983323-159983345 CACCATCCCCCATCCCCACCCGG + Intergenic
1000850677 5:166336328-166336350 CCCCATTCCTCCCTTCCACCAGG - Intergenic
1001095961 5:168775732-168775754 ACCCATCCCTCACCCCTTCCAGG + Intronic
1001392163 5:171388045-171388067 CCCCCACCCTCACCGCCACCAGG - Intronic
1001635558 5:173207602-173207624 CACCATCCCTCCCCTCCACCAGG - Intergenic
1002449448 5:179310556-179310578 CACCATCCCTCACCCCAGCCGGG - Intronic
1003493226 6:6641912-6641934 CTCCATCCCTCAGCAACCCCTGG + Intronic
1003849427 6:10206629-10206651 CCCCACCTCTCACTCCCACCTGG - Intronic
1003940023 6:11015499-11015521 CCCCGTCCATCGCCACCACCAGG + Intronic
1004270024 6:14186782-14186804 CCCCATCCCCCACCCACCCCGGG + Intergenic
1004444472 6:15685511-15685533 AACCATCCCTCTGCACCACCCGG + Intergenic
1005755353 6:28921040-28921062 ACCCAACCCCCACCACCAACAGG + Intronic
1006333925 6:33410878-33410900 CCACCTCCCTCACCTCCAACAGG - Intronic
1006912674 6:37573887-37573909 CCCCATCCCCCACCACTCCCTGG + Intergenic
1007514491 6:42400541-42400563 CCCAATCACCCACCACCACCAGG + Intronic
1007960837 6:45957522-45957544 CACCAGCCCTCCCCAGCACCTGG - Intronic
1008468320 6:51855035-51855057 CGCGAACCCACACCACCACCCGG - Intronic
1008660854 6:53665891-53665913 CCCAACCCCTCTCCACCAACCGG - Intergenic
1009612238 6:65960976-65960998 CCCAATCTCTCTCCACCAACAGG + Intergenic
1009916206 6:70000017-70000039 CTCCATCCCTCAACAGCCCCTGG + Intronic
1010774046 6:79864680-79864702 TCCCATACCTCACCAGAACCAGG - Intergenic
1011421842 6:87181287-87181309 CCCCACCCCTCCCCACCTTCTGG - Intronic
1011591239 6:88972528-88972550 CCCCATTCCTCACCCCAGCCCGG + Intergenic
1012571688 6:100737377-100737399 CTCCCTCCCTCACCCCCAACAGG + Intronic
1012762001 6:103314466-103314488 CCCCATCCCTCAACAGGCCCTGG + Intergenic
1013218514 6:108053924-108053946 CCTCGTCCTTCACCACGACCGGG + Intronic
1013305461 6:108843549-108843571 CACCAACCCCCACCATCACCGGG - Intergenic
1015016396 6:128418586-128418608 CCCAATCCCTCACCCTCATCTGG + Intronic
1015435185 6:133178077-133178099 CCCCACCCCTCACCAGGTCCCGG + Intergenic
1015720592 6:136237108-136237130 CCCCATCCCTCCTGACCACAAGG + Intronic
1016014304 6:139167832-139167854 CTCCTTCCACCACCACCACCGGG - Intronic
1017105143 6:150880261-150880283 CCCCATCCCTCTCCAGCCTCTGG + Intronic
1017212691 6:151874813-151874835 CCCCATTCACCACCATCACCAGG - Intronic
1018051928 6:160016651-160016673 CATCATCCCTCACCACACCCTGG + Intronic
1019529732 7:1497372-1497394 CCCCTTCCCGCAGCACCAACAGG + Intronic
1020131127 7:5559142-5559164 AATCATCCCTCACCACCCCCAGG + Intronic
1020319710 7:6930639-6930661 CCCCATCCCAGGTCACCACCTGG - Intergenic
1020568301 7:9824698-9824720 CCTCATCCCTCACCCCCAACAGG + Intergenic
1021600109 7:22356611-22356633 CCCCACACCTCCCCCCCACCAGG - Intronic
1021986403 7:26102021-26102043 CCCAATCCCCCACCCCCACCGGG - Intergenic
1022148227 7:27569669-27569691 CTCCATCCCCCACTGCCACCCGG + Intronic
1022382476 7:29873202-29873224 CCCCATCCCTCACTAGCCCTTGG - Intronic
1022448706 7:30493543-30493565 ACCCTAACCTCACCACCACCAGG - Intergenic
1023568377 7:41547624-41547646 CCCCATCCCTCTGCACCATGAGG - Intergenic
1023658614 7:42451021-42451043 CTCCATACCTCCTCACCACCTGG - Intergenic
1023837102 7:44074584-44074606 CCCCATCCCTCACCAGCATGAGG + Intronic
1023849080 7:44140427-44140449 CCTCATGCCCCACCCCCACCAGG - Exonic
1024543650 7:50499690-50499712 CCCACTCCATCCCCACCACCAGG + Intronic
1025004495 7:55343802-55343824 CGCCATCCCTCACCACCTGCGGG - Intergenic
1025996053 7:66528214-66528236 CCCCATCCCTCTGCAACCCCAGG - Intergenic
1026198460 7:68193514-68193536 CCCCCGCCGCCACCACCACCTGG - Intergenic
1026972348 7:74476078-74476100 CCCCATCCCTCACCACCACCAGG - Intronic
1027677349 7:81176990-81177012 CCCAGTCCCTCACCCCCAACAGG + Intronic
1029197334 7:98814743-98814765 CCACAACCATCACCACCATCAGG - Intergenic
1031983802 7:128149190-128149212 CCTGATCCCTTCCCACCACCAGG - Intergenic
1033220662 7:139524554-139524576 CCACATGCCCCACCACCACGGGG - Intronic
1033266644 7:139892809-139892831 CCCCATACCTCACCAGCTCGGGG + Intronic
1033447643 7:141436622-141436644 CCCCAGCCCCCACCAGCTCCGGG - Intronic
1034547282 7:151797232-151797254 CCCCACCCCCCACCGCCGCCTGG + Intronic
1034980334 7:155471694-155471716 CCCCATCCCTTCCCCCCACAAGG + Intergenic
1035268089 7:157703311-157703333 CCCCATCAGCCGCCACCACCTGG - Intronic
1035396704 7:158539701-158539723 CCCCAGCCGTCACCAACTCCAGG - Intronic
1035396717 7:158539778-158539800 CCCCAGCCGTCACCAGCTCCAGG - Intronic
1035396754 7:158540002-158540024 CCCCAGCCGTCACCAGCTCCAGG - Intronic
1035564406 8:631504-631526 CCCAATCCGTCACCACTTCCTGG - Intronic
1036206019 8:6806263-6806285 CCGCATCCCCCACCCCCACTAGG - Intergenic
1036282064 8:7408776-7408798 CCCCTTCCCTCAGCTCCACTAGG - Intergenic
1036339405 8:7902795-7902817 CCCCTTCCCTCAGCTCCACTAGG + Intergenic
1037877236 8:22554195-22554217 CCCCCTCCCCCACTCCCACCCGG + Intronic
1038319760 8:26515110-26515132 CCCCGCCCCTCCCGACCACCGGG - Intronic
1039350375 8:36757566-36757588 TCCCATCCCTCACCATAACCTGG - Intergenic
1039419510 8:37424279-37424301 CCCAATCCCTCATCATCTCCCGG + Intergenic
1039430314 8:37520442-37520464 CTCCCTCCCTCCCCACCTCCCGG + Intergenic
1039904146 8:41773836-41773858 CCCCATCCTTCTCCAGCACCGGG - Intronic
1040081767 8:43292323-43292345 ACCCCTCCCCCACCACCAACTGG - Intergenic
1040567853 8:48582814-48582836 CCCCATCCCTGGCTCCCACCCGG - Intergenic
1041256604 8:55984224-55984246 CCCCAAAACTCACGACCACCCGG - Intronic
1041746441 8:61213032-61213054 CACTATCCCTCACCACTCCCAGG + Intronic
1042415551 8:68513886-68513908 CCCCACCCCTCATCACTCCCGGG - Intronic
1042463155 8:69094385-69094407 CCTCACCCCCCTCCACCACCAGG - Intergenic
1044564634 8:93649630-93649652 CCCCAGCCCCAAGCACCACCAGG - Intergenic
1045050859 8:98323800-98323822 TTCCATCCATCACCACCAGCTGG + Intergenic
1045304936 8:100951082-100951104 ACCCATCCCCCACCCCCACCAGG + Intronic
1045737860 8:105318262-105318284 CCCCATCCCCCACCACCGCCTGG + Intronic
1046774523 8:118150009-118150031 CCCCCTCCCTTCCCATCACCAGG + Intergenic
1048467735 8:134681238-134681260 CCCCAAACCTCCCCACCAGCTGG - Intronic
1049084855 8:140470711-140470733 CCCCATCCCTCACAATCCACAGG + Intergenic
1049171463 8:141164050-141164072 CCCCATCCCTCCCCAGGTCCTGG + Intronic
1049398902 8:142416096-142416118 CCCCTGCCCACCCCACCACCCGG + Intergenic
1049690102 8:143954549-143954571 ACCCACCCCCCACGACCACCAGG + Intronic
1049817933 8:144616634-144616656 CCCCTGCCCTCCCCACCTCCTGG - Intergenic
1050201681 9:3151573-3151595 CCCCATACCTCACCAGAACTTGG - Intergenic
1052014042 9:23444311-23444333 CCCCAGCCATCACCACTCCCTGG + Intergenic
1052160686 9:25255132-25255154 CCCCCGCCGCCACCACCACCAGG + Intergenic
1053019967 9:34688010-34688032 CCCTATCCCTCCCACCCACCTGG + Intergenic
1055018747 9:71646675-71646697 CCCGACCCCTGCCCACCACCTGG - Intergenic
1056580240 9:87884717-87884739 CCCCCTCCCAGATCACCACCAGG - Intronic
1056689438 9:88794123-88794145 CCCCACCCCTCACCAGAAACAGG - Intergenic
1056789367 9:89615766-89615788 CCCAGTCCATCACCCCCACCTGG - Intergenic
1056831091 9:89918142-89918164 CCCCATCCCAGAGCAGCACCTGG + Intergenic
1057167643 9:92941228-92941250 CCCCATCCCCTACCACACCCTGG - Intergenic
1057704307 9:97386689-97386711 CCCCACTCCACACCCCCACCAGG - Intergenic
1057937719 9:99254719-99254741 CTCCATCCCTCCCCACCCCATGG + Intergenic
1058035979 9:100253568-100253590 CCCCATCCCACACCAGCCCCCGG + Intronic
1058246760 9:102635888-102635910 CCCCACCTCCCAACACCACCAGG + Intergenic
1059800662 9:117746471-117746493 CCCCAACCCCCACCACAAACTGG - Intergenic
1060149801 9:121281369-121281391 CCCCTTTCCTCCCCTCCACCAGG - Intronic
1060759988 9:126238862-126238884 CCACCTCCACCACCACCACCTGG - Intergenic
1060934713 9:127508345-127508367 CCTCATCCCCGGCCACCACCAGG - Intronic
1061259327 9:129471094-129471116 GCACAACCCTCACCAGCACCTGG - Intergenic
1061547535 9:131313405-131313427 CCCCATGCCCTTCCACCACCTGG + Intergenic
1061801190 9:133114160-133114182 CTGCATCCTTCCCCACCACCCGG - Intronic
1062140181 9:134951984-134952006 CCCGATCCCTCACCTCCTCTAGG + Intergenic
1062273779 9:135721290-135721312 CCCCCTACCCCACCACCCCCAGG - Intronic
1062324629 9:136006094-136006116 CCCCCTCCCCCACCCCCTCCCGG - Intergenic
1062421524 9:136484637-136484659 CCCCCTCCCTCACCAGCCGCCGG - Exonic
1062517331 9:136943249-136943271 CCCCCCCCCCCACCACCACCTGG + Intronic
1186204963 X:7191530-7191552 CCTCAGCCCTCACCTCCACCAGG - Intergenic
1186205042 X:7191828-7191850 CCTCAGCCCTCACTTCCACCAGG - Intergenic
1186441110 X:9587317-9587339 CCGCCTCCCTCCCCACCACTGGG - Intronic
1186901964 X:14066201-14066223 CCCCATCCCTACCCACGCCCTGG + Intergenic
1187174316 X:16882650-16882672 CCCCGCCCCTCCCCAGCACCAGG + Intergenic
1188004412 X:25007286-25007308 CCCCTTCCCTCCGCACCACCCGG - Exonic
1189051385 X:37649441-37649463 CCCCATCCCCCAACAGGACCTGG - Intronic
1189269876 X:39743699-39743721 CTCCATCCCTAACCACTCCCTGG - Intergenic
1189355933 X:40310006-40310028 CCTCATCTCTCAGAACCACCGGG - Intergenic
1189861968 X:45281963-45281985 CCTCACCCCTCACCCCCAACAGG + Intergenic
1189901359 X:45710245-45710267 CCCCCACCATCACCACCACAGGG - Intergenic
1190271581 X:48868107-48868129 CCCCACCCCTCCCCACAACCAGG - Intergenic
1190328052 X:49218766-49218788 CCCCAACCCCCACCATCCCCAGG - Intronic
1190381894 X:49847228-49847250 CTCCATCCCCCACCCCTACCTGG - Intergenic
1191083666 X:56540416-56540438 CACCTTCCCTCACCCCCAACAGG - Intergenic
1191880483 X:65839933-65839955 CCCCCAACCTCTCCACCACCAGG - Intergenic
1192554805 X:72080959-72080981 CCCCCTCCCCCACCACCACGTGG - Intergenic
1192858622 X:75040758-75040780 CCCCATCCCTCTGCAGCAGCAGG - Intergenic
1194202267 X:90967461-90967483 TCCCAAACCTCACCACCACAGGG + Intergenic
1195834004 X:109092043-109092065 CCCCATCCCACAACAACCCCCGG + Intergenic
1196371719 X:114986557-114986579 CACCTTCCTTCACCACCATCAGG + Intergenic
1197976078 X:132167212-132167234 ATTCATCCCTCACCAACACCTGG + Intergenic
1198215533 X:134550920-134550942 CCCCACCCCGCACCGCCCCCGGG - Intergenic
1198438828 X:136641912-136641934 CCCCACCCCGCCCCACCCCCTGG + Intergenic
1198586728 X:138129534-138129556 CTCCAGCCCTCCCCAGCACCTGG - Intergenic
1198667882 X:139044910-139044932 CCCCATCCCACAGCTCCACTAGG + Intronic
1199060192 X:143346765-143346787 CCCCACCCCACCCCACCAACAGG + Intergenic
1199845062 X:151686860-151686882 TCCCATCCCTCACTAGAACCAGG + Intergenic
1200071467 X:153531396-153531418 CCCCATCTCTCTCCACCTCCAGG - Intronic
1200548103 Y:4542915-4542937 TCCCAAACCTCACCACCACAGGG + Intergenic
1201499100 Y:14622348-14622370 CCCTATGCCTCACCCCCAACTGG + Exonic
1201577692 Y:15478444-15478466 CCTCATCCTTCACCTCCACAAGG - Intergenic