ID: 1026972353

View in Genome Browser
Species Human (GRCh38)
Location 7:74476103-74476125
Sequence GTGGCTATTTTGCAGTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026972348_1026972353 2 Left 1026972348 7:74476078-74476100 CCTGGTGGTGGTGAGGGATGGGG 0: 1
1: 0
2: 6
3: 57
4: 588
Right 1026972353 7:74476103-74476125 GTGGCTATTTTGCAGTTGGATGG No data
1026972344_1026972353 8 Left 1026972344 7:74476072-74476094 CCAATGCCTGGTGGTGGTGAGGG 0: 1
1: 0
2: 2
3: 32
4: 332
Right 1026972353 7:74476103-74476125 GTGGCTATTTTGCAGTTGGATGG No data
1026972341_1026972353 16 Left 1026972341 7:74476064-74476086 CCTCTTCTCCAATGCCTGGTGGT 0: 1
1: 0
2: 0
3: 15
4: 186
Right 1026972353 7:74476103-74476125 GTGGCTATTTTGCAGTTGGATGG No data
1026972338_1026972353 30 Left 1026972338 7:74476050-74476072 CCTGTACAAAACAGCCTCTTCTC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1026972353 7:74476103-74476125 GTGGCTATTTTGCAGTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026972353 Original CRISPR GTGGCTATTTTGCAGTTGGA TGG Intronic
No off target data available for this crispr