ID: 1026973079

View in Genome Browser
Species Human (GRCh38)
Location 7:74479599-74479621
Sequence GAGCTGCCGGGACCCTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026973079_1026973084 -4 Left 1026973079 7:74479599-74479621 CCCTGGGAGGGTCCCGGCAGCTC 0: 1
1: 0
2: 1
3: 17
4: 203
Right 1026973084 7:74479618-74479640 GCTCAGGTGTCACCTCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026973079 Original CRISPR GAGCTGCCGGGACCCTCCCA GGG (reversed) Intronic
900417668 1:2542583-2542605 GAGCTGCCGGACCCCACCCAGGG - Intergenic
901003581 1:6160936-6160958 GTGCTGCCCGGCCCCTCCCTGGG - Intronic
903467105 1:23559324-23559346 CAGCTGCCGGGCCCTTCCCTCGG + Exonic
904033589 1:27547762-27547784 GAGCTGCCGGGACCTGCCGCTGG - Exonic
904211143 1:28887530-28887552 GACCTGCAGGGACTCTCCCGCGG - Intronic
904417302 1:30371214-30371236 GGGCTGCCAGGATTCTCCCAGGG + Intergenic
905025433 1:34846351-34846373 GAGCTGAGGGGACCCTGCCCGGG - Intronic
906528839 1:46511820-46511842 AAGCTCCAGGGACCCTGCCAAGG - Intronic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
915626621 1:157117868-157117890 GAGCTGAAGGGCCCCTCCCCTGG + Intergenic
922500159 1:226091357-226091379 GAGCTGCAGGGACCCTGAAAGGG - Intergenic
924384830 1:243490874-243490896 GTGCTGCTGGGGCCCTCCCTGGG - Intronic
1062938241 10:1403602-1403624 CAGCTGCCGGGCCCCTCACGTGG - Intronic
1064146597 10:12830740-12830762 GACCTGCCGGGACACCCCCGTGG - Exonic
1067067611 10:43112613-43112635 AAGAGGCCGGGACCCTCTCAGGG - Intronic
1067945022 10:50683735-50683757 GAGCTGCTGGGGCCTTCCCTCGG + Intergenic
1069686455 10:70322213-70322235 GAGCTGCTGTGAGCCTTCCAAGG + Intronic
1070866526 10:79710606-79710628 GAGCTGCTGGGGCCTTCCCTCGG + Exonic
1070880316 10:79848737-79848759 GAGCTGCTGGGGCCTTCCCTCGG + Exonic
1071351468 10:84750336-84750358 AGGCTGACTGGACCCTCCCAAGG - Intergenic
1071633436 10:87232827-87232849 GAGCTGCTGGGGCCTTCCCTCGG + Exonic
1072252230 10:93590844-93590866 GGGCCCCCGGGAGCCTCCCACGG + Intronic
1072271423 10:93780766-93780788 GAGCTGGCTGGATCCTTCCATGG + Intronic
1074815211 10:117137451-117137473 GACCTGCCGGGAGCCGGCCAGGG - Intronic
1075510965 10:123072878-123072900 GAGGTGCTGGGACCAGCCCAAGG + Intergenic
1075778258 10:125001708-125001730 GAGCTGCCCGTACACTCACAGGG - Intronic
1076432982 10:130420119-130420141 GAGTTGCTGGGACCAGCCCACGG - Intergenic
1076611489 10:131728787-131728809 GGGCTGCCGGACCCCTTCCAGGG + Intergenic
1077526415 11:3068230-3068252 GAGTTGCTCAGACCCTCCCAGGG - Intergenic
1079134050 11:17766083-17766105 GAGCTGCCGGGGCACAGCCAGGG + Intronic
1080308233 11:30859942-30859964 GAACAGCCGGGCTCCTCCCAGGG + Intronic
1083206458 11:61152543-61152565 GAGCTCCCATGGCCCTCCCATGG + Intronic
1083924447 11:65797552-65797574 GGCCTCCCAGGACCCTCCCAGGG + Intergenic
1084470117 11:69354401-69354423 GAGCTGCTGGGACTTGCCCAAGG + Intronic
1084534854 11:69750660-69750682 AAGGTGGCTGGACCCTCCCAGGG + Intergenic
1085415263 11:76315420-76315442 GAGTTGGCGGTACCATCCCAGGG + Intergenic
1091583270 12:1801359-1801381 GAGCTGCGGAGCCCCTCCCAGGG + Intronic
1091641568 12:2241104-2241126 AAGCTGCCAGGAGCCTCGCAAGG - Intronic
1091767835 12:3133465-3133487 CAGCCCCAGGGACCCTCCCAGGG + Intronic
1091805397 12:3352438-3352460 GAGCTGCAGGCTCCCTCCCATGG + Intergenic
1094219003 12:27973823-27973845 AAGCTGATGGGATCCTCCCATGG + Intergenic
1097170695 12:57111040-57111062 GAGCTCTCGGGATCCTCCCCTGG - Intronic
1098202333 12:68069104-68069126 GGGCAGCAGGGACCCTCTCAGGG + Intergenic
1101747046 12:107550375-107550397 GACCTGCCTGGACCCTAACAAGG + Intronic
1101995497 12:109522473-109522495 GAGCTGCAGGGACCCTGCCTGGG + Intronic
1102004891 12:109582841-109582863 GAGCTGGCTGGCCCTTCCCAGGG - Intronic
1102010681 12:109616613-109616635 GAGCTGCTGGGAGTCTCCGAAGG + Intergenic
1102600770 12:114028563-114028585 GAGGTTAAGGGACCCTCCCAAGG - Intergenic
1104736784 12:131139945-131139967 GAGCAGAGGGGACCCCCCCAAGG - Exonic
1109528977 13:63615033-63615055 GAGCTGCAGGGATACTACCAGGG + Intergenic
1113892355 13:113743155-113743177 GAGCTGCTGGGACCTGCCAAGGG - Intergenic
1113897737 13:113776543-113776565 GAGCTGCTGGCTCCGTCCCACGG + Intronic
1118730026 14:68659555-68659577 GGGCAGTCGGGACCCTCCCAAGG - Intronic
1118818780 14:69331300-69331322 CAGCTGCCAGGAGCCTGCCAGGG + Intronic
1119922172 14:78456690-78456712 TAGCAGAGGGGACCCTCCCATGG - Intronic
1121731364 14:96189401-96189423 GGGCTGCCCAGAGCCTCCCAGGG - Intergenic
1122352218 14:101102872-101102894 GAGCTGCCCCGATCCCCCCAGGG - Intergenic
1122728781 14:103779522-103779544 GAGGTGCTGGGATTCTCCCAAGG + Intronic
1123065148 14:105615176-105615198 GGGCTCCCGGCACCCTCTCAGGG + Intergenic
1125185449 15:36924681-36924703 GACCTGCTGGGACTTTCCCATGG + Intronic
1125518911 15:40337635-40337657 GGGCTGCAGGGACCCTCCTCGGG - Intronic
1126786164 15:52179544-52179566 CAGGTGCCCGGACCCTCCGAGGG + Intronic
1127825850 15:62702133-62702155 GAGCTGCCAGGACCCTCGCTGGG + Exonic
1128227309 15:66011114-66011136 GAGCTGCTCTGACCCTCCAAGGG + Intronic
1128758040 15:70196465-70196487 GAGCAACCAGGCCCCTCCCAGGG + Intergenic
1129082181 15:73051721-73051743 GCGCGGCCGGCCCCCTCCCACGG + Exonic
1129111845 15:73341724-73341746 GAGGGGCCGTGACTCTCCCAAGG - Intronic
1132478303 16:153468-153490 AAGCTCCCTGGCCCCTCCCAGGG - Intronic
1132480388 16:164058-164080 AAGCTCCCTGGCCCCTCCCAGGG - Intronic
1132648924 16:1011805-1011827 CAGCTGCCCCGACTCTCCCAGGG + Intergenic
1133125942 16:3646112-3646134 GAGCTGACAGGAAGCTCCCAGGG - Intronic
1133283444 16:4679833-4679855 GAGCTGCCGAGACGCACACATGG + Intronic
1133287014 16:4695189-4695211 GAGCTGGTGGCACCCTCCCCTGG + Exonic
1136346734 16:29680585-29680607 GAGAAGCCAGGACCCACCCATGG - Intronic
1141604856 16:85146931-85146953 CAGCTGCAGTGACTCTCCCAGGG - Intergenic
1142376724 16:89710548-89710570 GAGCTGCGGCGGCTCTCCCAGGG + Intronic
1203123738 16_KI270728v1_random:1559334-1559356 GACCTGCCGTGACCCTGCCTTGG + Intergenic
1144750065 17:17642380-17642402 GAGCTCCCTGGATCCTCCAAAGG - Intergenic
1144847434 17:18227208-18227230 GAGCTGCCAGGACCCTCACACGG + Intronic
1145267177 17:21385522-21385544 GAGCGGCCAGGTCCCTCCCCAGG + Intronic
1146674065 17:34760908-34760930 GAGCTGCCAGGACTCTCACAGGG + Intergenic
1147211991 17:38877274-38877296 GAGGTGCAGGGCCCCGCCCAAGG + Intronic
1147493984 17:40898253-40898275 GATCTGACTGGACCCTGCCATGG - Intergenic
1147968396 17:44206675-44206697 GAGCTGCCTGGACCCGTTCATGG - Exonic
1150951277 17:69804574-69804596 GATCTGACTGGATCCTCCCATGG - Intergenic
1152057421 17:78040951-78040973 GAGCTGCCAGGAAGCTCCCGGGG - Intronic
1152109126 17:78347657-78347679 GAGCAGCCCAGACCCTCCCTCGG - Intergenic
1154139580 18:11811183-11811205 GAGCCTCCTGGACCGTCCCACGG + Intronic
1154344445 18:13530713-13530735 GACATGCAGGGACCCTGCCAGGG + Intronic
1154481053 18:14825225-14825247 CACCTGCCGGGTCCATCCCATGG + Intronic
1155407921 18:25510779-25510801 GAGCTGCCCGTAAGCTCCCAGGG - Intergenic
1157480701 18:48051774-48051796 GAGCTGGCGGGACACACCAATGG + Intronic
1160834075 19:1116450-1116472 GGGCTGCTGTGACCCTCCCGGGG + Intronic
1160892784 19:1388002-1388024 GATGTGCCGGGACCCTCCCTGGG + Intronic
1161009782 19:1954641-1954663 GGGCTCCCGGGGCCCTCCCCAGG + Intronic
1161073409 19:2273591-2273613 CAGCTGCGGGACCCCTCCCACGG + Intronic
1161321557 19:3643921-3643943 GGGCTGCTGGGACCGCCCCAGGG - Intronic
1162115063 19:8424166-8424188 GGGATGCCGGGTCCTTCCCAGGG - Intronic
1163694598 19:18757516-18757538 GACCTGCCGGGTACCTCCAAGGG - Intronic
1163845992 19:19638250-19638272 GACCTGCGGGCACGCTCCCAGGG - Exonic
1164439232 19:28259423-28259445 GAGCTGCCTGTACCCTCACGGGG - Intergenic
1164556499 19:29256706-29256728 GAGCTGCTCTGCCCCTCCCAGGG - Intergenic
1165094959 19:33405229-33405251 GGGCTGGCGGGTCCCTGCCATGG - Intronic
1166302466 19:41919702-41919724 CAGCTGCCGGGGTCCTCTCAGGG + Intronic
1166913308 19:46176717-46176739 GGGTGGCAGGGACCCTCCCAGGG - Intergenic
1167331606 19:48859631-48859653 GGGCCGCCGGGGCCCTCCCCGGG + Exonic
1167473527 19:49687993-49688015 CAGCTGCCCTGACCCTGCCAAGG - Intronic
1168284713 19:55325185-55325207 GACCTGCTTGGACCCTCCCTGGG + Intronic
925298830 2:2795614-2795636 GAGCTGCCCACACCATCCCAGGG - Intergenic
926148977 2:10414071-10414093 GAGGTTCCGGGGCTCTCCCAGGG + Intronic
926159217 2:10475974-10475996 AAGCTGCCCGGGGCCTCCCAGGG + Intergenic
934529710 2:95077237-95077259 AACCTGCAGGGACCCTACCAGGG + Intergenic
935408673 2:102736553-102736575 GAGCTTCCGGGGAGCTCCCAGGG - Intronic
937317577 2:120941727-120941749 GAGCTCCGTGGACCCACCCATGG + Intronic
938081339 2:128371808-128371830 GAGCAGCTGTGACCTTCCCAAGG - Intergenic
938976179 2:136480706-136480728 GGGTGGCAGGGACCCTCCCAGGG + Intergenic
941164761 2:162073540-162073562 GAGCAGCCCCGACCCTCCTACGG - Intronic
944743722 2:202635582-202635604 GAGCTCGCGGGAGCCCCCCACGG + Exonic
945243046 2:207694032-207694054 GAGCTGAAGTGACCCGCCCAAGG - Intergenic
948889001 2:240897749-240897771 GAGAAGCCGAGCCCCTCCCATGG - Intergenic
1169123268 20:3109982-3110004 GAGCTGCCTGCTCCCTCCCGGGG - Exonic
1169276015 20:4234209-4234231 GAGCTGCTGGGACGCTGCTAAGG + Intronic
1172098564 20:32472697-32472719 CAGCTGCCTGGGCCTTCCCAAGG + Intronic
1172140668 20:32720832-32720854 GAGATGCTGTGACCCTCCCAGGG - Intronic
1175285925 20:57836693-57836715 GAGCAGCCCCCACCCTCCCAGGG + Intergenic
1175931004 20:62493700-62493722 GCGCTGCTGGGACCCCTCCAGGG - Intergenic
1176866868 21:14058785-14058807 GACCTGCCCTGACCCTGCCATGG - Intergenic
1179998941 21:44986508-44986530 GAGCTGCCGGGAGGGTCTCAGGG - Intergenic
1180216651 21:46327868-46327890 GAGCTGCAGGGGCACCCCCATGG + Intronic
1181319013 22:21990520-21990542 CTGTTGCCGGGCCCCTCCCAGGG + Intergenic
1181427882 22:22855927-22855949 GAGCTCCTAGGACCCACCCAGGG - Intronic
1181437891 22:22921004-22921026 GGGCATCCAGGACCCTCCCAGGG + Intergenic
1181568517 22:23753662-23753684 TGGCTGCAGGGACCCTCTCAGGG + Intronic
1182146765 22:28001509-28001531 GAGCTGCCGGTGCCGGCCCACGG + Exonic
1182147822 22:28007683-28007705 GACCTGCCTGGAACCTGCCAGGG + Intronic
1183314537 22:37129600-37129622 GAGGTGCAGGGGCCCTCCCAGGG - Intronic
1183539878 22:38423748-38423770 GACCTGGCGAGACCCACCCAGGG + Intergenic
1184276568 22:43412214-43412236 GCGCGGCCGGGACCCTCTCCAGG + Intronic
949878376 3:8641910-8641932 GAGCAGCTGGGACTCTCCCTTGG - Intronic
952383336 3:32820801-32820823 GAGCTTCCGAGTACCTCCCAGGG - Intronic
954277679 3:49553356-49553378 GAGGGGCCAGGACCCTCCCTGGG - Intergenic
955230797 3:57097365-57097387 GAGCTGCCCAGACCCTGCAAGGG - Intronic
961723377 3:128910278-128910300 GAGCAGCACAGACCCTCCCACGG - Exonic
968655772 4:1777863-1777885 GAGCAGCCCTCACCCTCCCAAGG - Intergenic
968757264 4:2423306-2423328 GGCCTGCTGGGACCCTCCCGAGG + Intronic
973208792 4:47591346-47591368 GAGATGGCTGGACCCTCCAAAGG + Exonic
975465454 4:74704279-74704301 GAGCTGCTGGGACACTGCAAGGG - Intergenic
975888025 4:78989063-78989085 AAGCTGCCGTGACCCTTCCATGG - Intergenic
976795804 4:88931129-88931151 GGGTGGCAGGGACCCTCCCATGG + Intronic
984756205 4:183327947-183327969 CAGCTCCCGGGACCCTCCCCGGG - Intergenic
986318481 5:6608118-6608140 GAGAAGCCGGGAGCATCCCAGGG + Intronic
992195661 5:74336537-74336559 CAGCTGCCGGGGCCCTCCGCAGG + Intergenic
992458800 5:76941310-76941332 TTCCTGCCGGGTCCCTCCCAGGG - Intergenic
993634957 5:90332097-90332119 GGGCAGCAGGGACCCTTCCAGGG + Intergenic
1001990541 5:176112581-176112603 GAAATGAGGGGACCCTCCCAGGG - Intronic
1002226332 5:177725559-177725581 GAAATGAGGGGACCCTCCCAGGG + Intronic
1002267516 5:178045654-178045676 GAAATGAGGGGACCCTCCCAGGG - Intronic
1002382902 5:178842898-178842920 GTGCTGCCTGGACCCTCCTTGGG - Intergenic
1004244891 6:13964869-13964891 GGGCTGCCAGGACCCTTCCAAGG - Intronic
1007358256 6:41336148-41336170 GAGATGCCAGTACCCGCCCACGG + Exonic
1015982374 6:138852174-138852196 GCCCCGCCGGGATCCTCCCAAGG - Intronic
1017612144 6:156199048-156199070 GAGTTGCCGGGGCAGTCCCAAGG + Intergenic
1018653548 6:166010842-166010864 GAGCTGCAGGGCCCATGCCAGGG + Intergenic
1018712592 6:166507272-166507294 GAGCTGCAGGGGCGCTGCCAGGG + Intronic
1019019139 6:168902870-168902892 GAGCTGCATGGAGCATCCCAGGG + Intergenic
1026973079 7:74479599-74479621 GAGCTGCCGGGACCCTCCCAGGG - Intronic
1028949660 7:96620293-96620315 GGGCAGTAGGGACCCTCCCAGGG + Intronic
1031940040 7:127778889-127778911 GAGCTGCTGGCTGCCTCCCAGGG + Intronic
1033600556 7:142885665-142885687 GGGCTGCTGGGAGACTCCCAAGG - Exonic
1034335884 7:150323338-150323360 GAGCTCCCGGAACGCGCCCAGGG - Exonic
1034979475 7:155467028-155467050 GCGGAGCCGGGACCCTCCCGGGG - Intergenic
1036641280 8:10585586-10585608 GAGCTTCTGGGAAACTCCCAGGG - Intergenic
1037319508 8:17630067-17630089 GAGCTGTTGGGACACTCCCATGG + Intronic
1037629590 8:20641949-20641971 GAGCTGCTGGTGCCCTCACAGGG + Intergenic
1038566301 8:28622623-28622645 GCGGAGCCGGGAGCCTCCCAGGG + Intronic
1040286488 8:46103146-46103168 GAAATGCTGGGAGCCTCCCAAGG - Intergenic
1040288918 8:46114382-46114404 GAAATGCTGGGAGCCTCCCATGG - Intergenic
1040291516 8:46127946-46127968 GAAATGCTGGGATCCTCCCAAGG - Intergenic
1040295427 8:46146569-46146591 GAAATGCTGGGAGCCTCCCAAGG - Intergenic
1040295700 8:46147991-46148013 GGAATGCCGGGAGCCTCCCAAGG - Intergenic
1040299173 8:46179126-46179148 GAAATGCTGGGAGCCTCCCAAGG - Intergenic
1040300833 8:46187203-46187225 GGGATGCTGGGAGCCTCCCAAGG - Intergenic
1040303126 8:46198365-46198387 GAAATGCTGGGAGCCTCCCAAGG + Intergenic
1040306406 8:46214155-46214177 AAAATGCTGGGACCCTCCCAAGG + Intergenic
1040307726 8:46220880-46220902 GAAATGCTGGGAGCCTCCCAAGG + Intergenic
1040308654 8:46225309-46225331 GGGATGCTGGGAACCTCCCAAGG + Intergenic
1040310422 8:46234024-46234046 GAAGTGCTGGGAGCCTCCCAAGG + Intergenic
1040315474 8:46258659-46258681 GAAATGCTGGGAGCCTCCCAAGG + Intergenic
1040315693 8:46259729-46259751 GAAATGCCAGGAGCCTCCCAAGG + Intergenic
1040323796 8:46331129-46331151 GAAATGCTGGGAGCCTCCCAAGG + Intergenic
1040324349 8:46334182-46334204 GAAATGCTGGGAGCCTCCCAAGG + Intergenic
1040330373 8:46382819-46382841 GGAATGCTGGGACCCTCCCAAGG + Intergenic
1040330426 8:46383035-46383057 GAAATGCTGGGAGCCTCCCAAGG + Intergenic
1040335161 8:46412412-46412434 GAAATGCTGGGAGCCTCCCAAGG + Intergenic
1040337463 8:46423332-46423354 GAAATGCTGGGAGCCTCCCAAGG + Intergenic
1040385166 8:46910195-46910217 CTGCTGCCGGGATCCTCCCCAGG + Intergenic
1042190058 8:66177375-66177397 GAGCTCCCGGGACCGGCCCGCGG + Exonic
1045507876 8:102791264-102791286 GAGCTGCAGGGCCCCCCCCCGGG - Intergenic
1049675703 8:143887974-143887996 GAGCTCCTGGGCCCCTCGCAGGG + Intergenic
1054455874 9:65430160-65430182 GTGCAGCCGGTACCCTGCCAAGG + Intergenic
1060481673 9:124019869-124019891 GACCTGCAGGACCCCTCCCAAGG - Intronic
1061665261 9:132156995-132157017 GCGATGCCGGTTCCCTCCCAGGG + Intergenic
1061667601 9:132169460-132169482 CTACTGCCCGGACCCTCCCAGGG - Intronic
1061896807 9:133652499-133652521 GAGCAGACAGGACACTCCCAGGG + Intronic
1062122626 9:134841890-134841912 GAGGCGACAGGACCCTCCCAAGG - Intronic
1062136159 9:134929547-134929569 GAGCTGCTGGGTCCCTGCCCAGG - Intergenic
1062320758 9:135989552-135989574 GAGCTGCAGGGACCCTTGGAGGG + Intergenic
1062359045 9:136178766-136178788 GAGCTGGAGGGACCCTCCTGGGG + Intergenic
1062459626 9:136657481-136657503 GAGACCCCGGGACCCTCCCCAGG + Intergenic
1062628794 9:137454474-137454496 GGGCTGCCGTCACCCTCTCACGG - Intronic
1186611591 X:11143225-11143247 GATCTGCTGGGAACCTCCTAGGG - Intronic
1188427600 X:30067336-30067358 GGGCAGCAGGAACCCTCCCAGGG - Intergenic
1189134042 X:38531446-38531468 GAGCTGCCTGGACCCGCTTATGG - Intronic
1189301100 X:39952946-39952968 GAGCTGCTGGGAATCCCCCAGGG - Intergenic
1190328151 X:49219275-49219297 GAGCTGAGGGGACACTCCCAGGG - Intronic
1191211749 X:57892080-57892102 GAGCAGTAGGGACCCTCCCAGGG - Intergenic
1195320925 X:103721474-103721496 GAGATCCCGGGTCCCTTCCATGG - Intronic
1195614264 X:106900422-106900444 GAGCTCCTAGAACCCTCCCATGG + Exonic
1196117291 X:112011479-112011501 GAGATCCCGGGAGCCTCCAACGG - Intronic
1199281340 X:146003782-146003804 GATCTGACGGGATCCTGCCATGG + Intergenic
1199970927 X:152860369-152860391 GAGCAGCAGGGCCCTTCCCAGGG - Intronic
1200310441 X:155071704-155071726 GAGCTGCCGGCACCCACCCCGGG - Intronic