ID: 1026977117

View in Genome Browser
Species Human (GRCh38)
Location 7:74505633-74505655
Sequence GCTGAGGCCCAAATCGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 59}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026977117_1026977124 11 Left 1026977117 7:74505633-74505655 CCTGATTCGATTTGGGCCTCAGC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1026977124 7:74505667-74505689 TGGCAGCCCTAAGGCCTTTCTGG 0: 1
1: 0
2: 0
3: 14
4: 115
1026977117_1026977123 2 Left 1026977117 7:74505633-74505655 CCTGATTCGATTTGGGCCTCAGC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1026977123 7:74505658-74505680 CTGGGAGGCTGGCAGCCCTAAGG No data
1026977117_1026977125 12 Left 1026977117 7:74505633-74505655 CCTGATTCGATTTGGGCCTCAGC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1026977125 7:74505668-74505690 GGCAGCCCTAAGGCCTTTCTGGG No data
1026977117_1026977127 17 Left 1026977117 7:74505633-74505655 CCTGATTCGATTTGGGCCTCAGC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1026977127 7:74505673-74505695 CCCTAAGGCCTTTCTGGGAATGG 0: 1
1: 0
2: 3
3: 21
4: 210
1026977117_1026977133 30 Left 1026977117 7:74505633-74505655 CCTGATTCGATTTGGGCCTCAGC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1026977133 7:74505686-74505708 CTGGGAATGGTTCAAGGGACGGG 0: 1
1: 0
2: 0
3: 13
4: 168
1026977117_1026977121 -9 Left 1026977117 7:74505633-74505655 CCTGATTCGATTTGGGCCTCAGC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1026977121 7:74505647-74505669 GGCCTCAGCAGCTGGGAGGCTGG 0: 1
1: 1
2: 5
3: 97
4: 939
1026977117_1026977129 24 Left 1026977117 7:74505633-74505655 CCTGATTCGATTTGGGCCTCAGC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1026977129 7:74505680-74505702 GCCTTTCTGGGAATGGTTCAAGG 0: 1
1: 0
2: 2
3: 12
4: 144
1026977117_1026977132 29 Left 1026977117 7:74505633-74505655 CCTGATTCGATTTGGGCCTCAGC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1026977132 7:74505685-74505707 TCTGGGAATGGTTCAAGGGACGG 0: 1
1: 0
2: 0
3: 8
4: 169
1026977117_1026977131 25 Left 1026977117 7:74505633-74505655 CCTGATTCGATTTGGGCCTCAGC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1026977131 7:74505681-74505703 CCTTTCTGGGAATGGTTCAAGGG 0: 1
1: 0
2: 0
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026977117 Original CRISPR GCTGAGGCCCAAATCGAATC AGG (reversed) Intronic
901082122 1:6589367-6589389 GCTGAGGCCCACATAGGACCGGG - Intergenic
903859003 1:26354107-26354129 GCTGAGAGCCCAATCGCATCAGG - Exonic
904640022 1:31919277-31919299 ATTGAGGCCCAAATTGAATTTGG - Exonic
906945792 1:50293097-50293119 GCTGATGACCAAAATGAATCTGG + Intergenic
915795392 1:158727063-158727085 TCTGAGGACCAAATAGAAACAGG + Intergenic
916189886 1:162168429-162168451 GCTGAGGACCAAAGAGAAACAGG - Intronic
920370289 1:205474553-205474575 GCTGAGACCTAAATAGAATGAGG - Intergenic
921319157 1:213920594-213920616 TCTGATGCCCAAATCGAAAAGGG - Intergenic
1092388609 12:8055113-8055135 ACTGAGGCCCAAAGGGAGTCAGG - Exonic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1102030516 12:109737622-109737644 GCTGAGGCCCAAATGGCAGTGGG + Intronic
1108004440 13:45933113-45933135 GATGAGTCCTAAATAGAATCAGG + Intergenic
1119787701 14:77325461-77325483 GCTGAGGTTTAAATGGAATCAGG - Intronic
1121464752 14:94108448-94108470 GCTGAGGCTCAAATCACTTCTGG - Intronic
1121911511 14:97796330-97796352 GCTGAGGGGCAAATTAAATCAGG + Intergenic
1122814477 14:104305711-104305733 GCTGAGGCCCAAGTCAAGTCCGG - Intergenic
1122951578 14:105047880-105047902 GGTGAGGCCCAAATGGGACCAGG - Intergenic
1123889693 15:24764284-24764306 CCTGAGGGCCAAATCGCTTCTGG - Intergenic
1128890530 15:71327877-71327899 TCTGAGGCTCAAATGGTATCAGG - Intronic
1129163011 15:73757710-73757732 GCTGGGGCCCAAATCCAAGTTGG - Intergenic
1129753137 15:78079964-78079986 GGTGAGGCCCAAATTGAACTTGG - Intronic
1130350860 15:83090528-83090550 GTTGTGGCCCAAATGAAATCAGG - Intergenic
1142560645 17:807151-807173 GCTGCAGCCCAAAGGGAATCCGG + Intronic
1145099641 17:20063938-20063960 GCTGAGGGCCAAATGGCCTCAGG + Intronic
1147719976 17:42533304-42533326 ATTGAGGCCCAAATTGAATTTGG + Intergenic
1149074327 17:52578585-52578607 GCTGAGGCCAAAATTGCTTCCGG + Intergenic
930493691 2:52110125-52110147 GTTGAGGCCCTAATCCAATAGGG + Intergenic
935523372 2:104137488-104137510 ACTGAGGCCGAAAACAAATCAGG - Intergenic
937254731 2:120547146-120547168 ACTGAGGCCCAGAAGGAATCAGG + Intergenic
943639563 2:190343713-190343735 GCTGAGGCCAAGCTCGGATCCGG + Exonic
948867330 2:240782632-240782654 GCTGAGGCCCGGAGCGAAGCTGG + Intronic
948877520 2:240837557-240837579 GCTGAAGCCAGAATAGAATCTGG - Intergenic
1172275201 20:33675560-33675582 TATGAGGCTCAAATCAAATCGGG + Intronic
1175993071 20:62799072-62799094 GCTGAGCCCCAAAGGGCATCAGG - Intronic
1178463256 21:32822552-32822574 GATGGGGCCCAAATCTAAACAGG + Intergenic
1183530863 22:38352604-38352626 ACTGAGGCCCAAATGGTATGGGG - Intronic
1183753620 22:39738179-39738201 CCTGAGGCCCTAATCGGAGCTGG + Intergenic
1183818949 22:40328575-40328597 TCTGAGGTCAAAATGGAATCTGG - Exonic
950522668 3:13505899-13505921 GCTGTGGCCCTGATCAAATCAGG + Exonic
961824068 3:129589662-129589684 GCTGAGGCCCAAACACAAACGGG + Intronic
964444633 3:156745924-156745946 GCTGAGGCCTGAATCAAATTAGG - Intergenic
968907657 4:3462142-3462164 ACTGAGGAGCAAATGGAATCAGG - Intergenic
973224361 4:47766068-47766090 GCAGAGCTCAAAATCGAATCTGG + Intronic
989209912 5:38848024-38848046 CCTGAGGACAAAACCGAATCAGG + Intronic
991307507 5:65195011-65195033 GCTTAGGCCAAAATGGAATAGGG + Intronic
998558582 5:143149652-143149674 GCTGAGACCCAAGTCGTCTCAGG - Intronic
1002019473 5:176353733-176353755 GCTGAGGCCCAGAAGAAATCTGG + Intronic
1008752310 6:54750400-54750422 GGTGAGGCCCTAATCCAATAGGG - Intergenic
1012491148 6:99783735-99783757 GCTGTGGTCCAAATCTAATCAGG + Intergenic
1015680931 6:135807788-135807810 ACTGATGCCCAAATCCAACCTGG + Intergenic
1019150608 6:170003160-170003182 GCTGAGGCTCCAATCCCATCAGG - Intergenic
1021499966 7:21321318-21321340 GCTGCGGCTCAAATGGAACCAGG + Intergenic
1023156994 7:37261303-37261325 GCTGAGGCTAAAATAGAAACTGG + Intronic
1026977117 7:74505633-74505655 GCTGAGGCCCAAATCGAATCAGG - Intronic
1033861427 7:145632683-145632705 GCTAAGGCCCAAATCTGATAGGG - Intergenic
1034069124 7:148165644-148165666 ACTGAGGCCCAAATAGGACCTGG + Intronic
1040493149 8:47943000-47943022 TCTGAGGCCCTAATCAAATCTGG + Intronic
1044234302 8:89812661-89812683 GCAGAGGCCAAAATAGAATAGGG - Intergenic
1052636490 9:31112658-31112680 GATGAGGCCAAAATAAAATCTGG + Intergenic
1055100319 9:72457231-72457253 GCTGAGGCCCAAGTTGAAAGTGG + Intergenic
1057497619 9:95573238-95573260 GCTGAGGCCAGAATGGAAACAGG + Intergenic
1059650422 9:116311020-116311042 ACTGAGGAACAAATCGAATTAGG + Intronic
1062536321 9:137022619-137022641 GCTGAAGCCCACATCCACTCTGG - Intronic