ID: 1026977660

View in Genome Browser
Species Human (GRCh38)
Location 7:74508214-74508236
Sequence GTCCCCTCCTCTTGGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 229}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026977660 Original CRISPR GTCCCCTCCTCTTGGGTGGG TGG (reversed) Intronic
900981250 1:6047518-6047540 GTCACCCTCTCTTGTGTGGGGGG - Intronic
901443984 1:9295716-9295738 TGCCCCTCCTCCTGGGTGGATGG + Intronic
902335334 1:15751276-15751298 ATGCCCTCCCCTCGGGTGGGTGG - Intergenic
902456456 1:16536837-16536859 GTCCTGTCCTGTTGGGTAGGCGG + Intergenic
902495707 1:16871074-16871096 GTCCTGTCCTGTTGGGTAGGCGG - Intronic
903193418 1:21668951-21668973 GTCCCACCCCCCTGGGTGGGTGG - Intronic
906537165 1:46557660-46557682 GTCCCCAGGTCTTGTGTGGGTGG - Exonic
908645729 1:66275764-66275786 TTTCCCTCCTCTTGGGTGAAAGG - Intronic
908671296 1:66550574-66550596 ATTCCCTCCTCTTGGGGGAGGGG - Intronic
908804546 1:67916677-67916699 CTCCCCTCCACTTGGGGGAGAGG + Intergenic
909745870 1:79096431-79096453 GTCCACTGCTCTTGGGAGGCTGG - Intergenic
910440527 1:87247094-87247116 ATCCCCTCCTCTTGAGTTGTGGG + Intergenic
920539077 1:206763902-206763924 GTCCTCTTCTCTTGGCTTGGAGG + Intergenic
920940010 1:210473412-210473434 GACCCCTCCTCTTGGCTAAGGGG - Intronic
920958740 1:210645152-210645174 GTCCCGTCCGCTAGGCTGGGTGG - Intronic
921355396 1:214280878-214280900 GCGCCCTCCTCCTCGGTGGGAGG - Intergenic
922099228 1:222468444-222468466 GGCTCCTCCTCTGTGGTGGGAGG - Intergenic
922735804 1:227977802-227977824 GGCCCCTCCTCCATGGTGGGAGG + Intergenic
922784689 1:228277075-228277097 CTCCCCTCCTCTCATGTGGGCGG + Intronic
1065813002 10:29459706-29459728 CTGCTCTCCTTTTGGGTGGGTGG + Intronic
1068334822 10:55621386-55621408 GACCCCTGCTCTGGGGTGCGGGG - Intronic
1068400017 10:56516327-56516349 GCCTCCTTCTGTTGGGTGGGGGG + Intergenic
1069954142 10:72039589-72039611 GACACCTCCTCCTGGGTGGCCGG - Intergenic
1070289117 10:75103440-75103462 GTCCCTGCCTTTTGGGTTGGGGG - Intronic
1070728374 10:78807965-78807987 CTTCCCTCCGCTTGGGTGTGAGG + Intergenic
1071429771 10:85597795-85597817 GTCCCTTCCTCTTTTGTAGGAGG + Intergenic
1072782451 10:98259814-98259836 CTGCCCTCCTCATGGGTGGCAGG + Intronic
1072954949 10:99880015-99880037 GTCCCCTGACCTTGGCTGGGAGG + Exonic
1073255370 10:102147369-102147391 TTCGCCACCTCTTGTGTGGGGGG - Exonic
1074467652 10:113697662-113697684 TCCCCCTCCCCATGGGTGGGTGG - Intronic
1076184307 10:128434484-128434506 AGCTCCTCCTCCTGGGTGGGGGG + Intergenic
1077446406 11:2593063-2593085 GTCCCCTCCTCATAGGGGAGTGG + Intronic
1081743493 11:45457216-45457238 GTCCCCTACTCTTGGATGCTGGG + Intergenic
1082740878 11:56909623-56909645 GTCCCCCCATTCTGGGTGGGGGG + Intergenic
1083741722 11:64714745-64714767 CTCCCCCAATCTTGGGTGGGGGG - Intronic
1083931392 11:65847989-65848011 GTCCCCTCCTCCTGGCTGTCCGG - Intronic
1084757493 11:71249061-71249083 GGCCTCTCATTTTGGGTGGGAGG + Intronic
1086883844 11:92180731-92180753 TTCCCTTCCTCTGGGGTAGGGGG - Intergenic
1088319239 11:108538089-108538111 GTCCTCCCCTCTTGGGTGAATGG - Intronic
1090272461 11:125397781-125397803 CTCCCCTCCCCTGGGGTGGTGGG + Intronic
1091169681 11:133508871-133508893 GTCCCGTCCTCTTGTCTGGAAGG - Intronic
1091221957 11:133935099-133935121 GGCCTCTCCCCTTGGGTGGCTGG - Intronic
1091551709 12:1540087-1540109 GAACCCACCTCTTGGTTGGGAGG - Intronic
1091577673 12:1754281-1754303 GTCCCCTCTTCTTGGGAGAATGG - Exonic
1092230434 12:6772938-6772960 GTCCCCTCCTGTGGGGCTGGAGG - Intronic
1092538794 12:9407056-9407078 GTCCCCGCCTCGCGGGGGGGGGG - Intergenic
1092688180 12:11074406-11074428 ATCCCCTCCTAATGGGTGTGAGG + Intronic
1093770917 12:23017630-23017652 ATCCCCTGCTCGTGGATGGGTGG + Intergenic
1095967655 12:47879615-47879637 GTCTCCTCCTCTTGAGGGTGGGG + Intronic
1096100780 12:48969549-48969571 GTCCCCTCCTCTGTGCTGTGGGG - Intronic
1096674057 12:53217111-53217133 CTTCCCTCCTGTGGGGTGGGTGG - Intronic
1097182262 12:57178242-57178264 GTCCCATGCTCTTCGCTGGGAGG + Intronic
1097283241 12:57858783-57858805 GTCCACTCCTGTTGAGAGGGAGG + Intergenic
1099687779 12:85911143-85911165 GTGCCCTCCTTTTGCTTGGGAGG - Intergenic
1105867124 13:24470992-24471014 TTTGCCTCCTCTTGGGTGGCTGG - Intronic
1106549093 13:30756125-30756147 GTAGCATCCCCTTGGGTGGGAGG + Intronic
1109533655 13:63687109-63687131 GTCCCCTCCCCTTGCATGGGAGG + Intergenic
1111305701 13:86409952-86409974 GCCCACTCATCTTGGCTGGGCGG - Intergenic
1114284845 14:21231463-21231485 GTCCCTGCTACTTGGGTGGGAGG - Intronic
1114437010 14:22714776-22714798 ATCCCCTCCTCCTGGGTAGTAGG - Intergenic
1119474648 14:74920118-74920140 AGCCCCTCCTCTGGGGTGGGGGG + Intronic
1119478987 14:74948184-74948206 TTCCCCTTCTCTGGGATGGGAGG - Intronic
1119639515 14:76304279-76304301 GTACCCCCCACTTGGGTGGGGGG + Intergenic
1121125999 14:91407086-91407108 TCCTCCTCCTGTTGGGTGGGGGG - Intronic
1121953671 14:98194975-98194997 ATCCTCTCTTCTTGGCTGGGAGG + Intergenic
1122512978 14:102284963-102284985 GTCCCGGCCACTTGGGAGGGTGG + Intronic
1122885506 14:104708640-104708662 GTACCAGCCTGTTGGGTGGGGGG + Intronic
1124193582 15:27600985-27601007 GTGCCCTCCTGTTGGGAGTGGGG + Intergenic
1127915227 15:63449990-63450012 GCCACCTCTGCTTGGGTGGGGGG - Intergenic
1129348915 15:74942720-74942742 ATCTCCTCCTCTTGAGTAGGGGG - Intergenic
1130547628 15:84868412-84868434 GAGCCCTCCTCTTGGGTGGGAGG - Exonic
1131180234 15:90234148-90234170 GGCCCCGCCTCCGGGGTGGGAGG + Intronic
1132545636 16:531772-531794 GTCCCCTTCTCTGGGGTGACAGG + Intronic
1132904711 16:2276678-2276700 CGCCCCTCCTCTGCGGTGGGCGG + Exonic
1133036628 16:3037052-3037074 GTCGCTTCCACCTGGGTGGGGGG + Intergenic
1134309740 16:13065011-13065033 GACCCCACCTCTTGGGAGGATGG + Intronic
1135422983 16:22317017-22317039 TTCTCCTCCTCCTGGCTGGGTGG - Exonic
1136053918 16:27673701-27673723 GTCCCCTGGAGTTGGGTGGGGGG + Intronic
1136275682 16:29178027-29178049 ATCCCCTCCTGTGGGGTGTGAGG - Intergenic
1136402131 16:30024784-30024806 GTCCTCTCCTCTCGGGTGATGGG + Exonic
1139010915 16:62633009-62633031 GACACCACCTATTGGGTGGGTGG + Intergenic
1139328504 16:66169850-66169872 TGCCCCTCCTCTTGGGAGGCAGG - Intergenic
1139852863 16:69961431-69961453 GACCCCTGCTCTTGGAAGGGAGG + Intronic
1139881834 16:70184339-70184361 GACCCCTGCTCTTGGAAGGGAGG + Intronic
1139899965 16:70320490-70320512 GCCCCCGCTACTTGGGTGGGAGG - Intronic
1139912763 16:70408348-70408370 CTCCCTGCCTCCTGGGTGGGGGG + Intronic
1140370676 16:74411167-74411189 GACCCCTGCTCTTGGAAGGGAGG - Intronic
1140386669 16:74546319-74546341 GTCCCAGCTCCTTGGGTGGGGGG + Intronic
1141270102 16:82531750-82531772 GTGCCCTCATTTTGGGTGGCTGG + Intergenic
1141651841 16:85397023-85397045 CTCCCCTCCAGCTGGGTGGGTGG + Intergenic
1141849469 16:86635394-86635416 GTCCCCTGGGATTGGGTGGGCGG - Intergenic
1142080038 16:88144082-88144104 ATCCCCTCCTCTGGGGTGTGAGG - Intergenic
1144744810 17:17606961-17606983 GTCACCTGCTCCTGGGTGGAGGG - Intergenic
1144779646 17:17801340-17801362 CTGCCCTCCTCTTGGGTAGCTGG + Intronic
1144848751 17:18233513-18233535 GTCCTCTCCTGGTGGGTGGGAGG + Intronic
1146526598 17:33572305-33572327 GACCCCTACCCTGGGGTGGGGGG - Intronic
1148028026 17:44601689-44601711 CTCCCCTGCTTGTGGGTGGGAGG - Intergenic
1148087767 17:45004757-45004779 GTGCCCATGTCTTGGGTGGGGGG + Intergenic
1148945474 17:51259448-51259470 GTCCTCTCTTCTTGGCGGGGAGG - Intronic
1149437116 17:56642592-56642614 ATTCCCACCTCTTTGGTGGGAGG + Intergenic
1151530088 17:74698543-74698565 CTCCCCTGCTGCTGGGTGGGTGG - Intronic
1152291146 17:79440878-79440900 GTCCCCTCGTATGGGGTGTGGGG - Intronic
1153774798 18:8443001-8443023 GTCCTCTCTTCTTGGGGGAGAGG - Intergenic
1156931049 18:42643879-42643901 GTCCCCTCCTCTCTGGTCTGTGG + Intergenic
1157819020 18:50751920-50751942 TTCCCCACCTTGTGGGTGGGCGG - Intergenic
1159567650 18:70071556-70071578 TTCTCCTCCTCTGGGGTAGGAGG - Intronic
1160967221 19:1752061-1752083 TTCCCCTTCTCTGGTGTGGGAGG - Intergenic
1160968067 19:1755271-1755293 CTCCCCTCCTCCAGAGTGGGTGG + Intronic
1160973811 19:1782525-1782547 GTCCCCTCCTTGGGGGTGTGAGG + Exonic
1161123017 19:2540526-2540548 GGCCCCTGCTCGGGGGTGGGTGG + Intronic
1161861059 19:6798663-6798685 TCCCCCTTCTTTTGGGTGGGGGG - Intronic
1163117028 19:15195264-15195286 GTACCCTCATCTTGGGGGGGTGG + Intronic
1163388600 19:17015735-17015757 TTGCCCTGCTCTTGGGTGGCCGG - Intronic
1163548454 19:17952387-17952409 GTCCCCTTCTCTTTGGTGGGCGG + Intronic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
1202707347 1_KI270713v1_random:33192-33214 GTCCTGTCCTGTTGGGTAGGTGG + Intergenic
925882275 2:8362859-8362881 GTGGCCTCCCCTGGGGTGGGAGG + Intergenic
928039732 2:27862667-27862689 GTCCCCTGCTCTTGACTCGGGGG + Intronic
928113149 2:28526317-28526339 GGGTCCTCCCCTTGGGTGGGAGG - Intronic
928585901 2:32757813-32757835 ATCCCAACTTCTTGGGTGGGAGG - Intronic
929564702 2:42977062-42977084 CTCCCCTCAGCTGGGGTGGGTGG + Intergenic
930476460 2:51888513-51888535 TTCCCCTCCCCCAGGGTGGGGGG + Intergenic
932716309 2:74102447-74102469 GTCCCCCCCCCTTGTCTGGGGGG + Exonic
932764006 2:74458730-74458752 GTCCCTTCCTTTTGGGGGTGGGG + Intronic
933686481 2:85145654-85145676 CTCCTCACCTGTTGGGTGGGCGG - Intronic
933803579 2:85982124-85982146 GTCCCAGCGACTTGGGTGGGGGG - Intergenic
933875926 2:86622615-86622637 GTCCCCTCCACCTGGGAGAGGGG - Intronic
933970816 2:87468605-87468627 CTCCTCCCCTGTTGGGTGGGTGG + Intergenic
936322914 2:111481591-111481613 CTCCTCCCCTGTTGGGTGGGTGG - Intergenic
936370331 2:111898156-111898178 GGACCCTCCTCTTGGGTCTGGGG + Intergenic
937575875 2:123421466-123421488 GTTCCCACCTCCTGGGTGGGTGG + Intergenic
939869416 2:147510474-147510496 GTCTCCTCCTTCTGGGTGGTGGG + Intergenic
942325737 2:174775830-174775852 GTCCCCTTCCCTTGGGTTGGAGG - Intergenic
946431550 2:219629296-219629318 CCCCCCTCCTCCTGGATGGGAGG - Exonic
948178225 2:235960463-235960485 GTCCCATTCTCTGGGGTGGCTGG + Intronic
948561983 2:238860390-238860412 GCCCATCCCTCTTGGGTGGGCGG - Intronic
1168819667 20:764429-764451 GGGCTCTCCTCTTAGGTGGGCGG - Intronic
1169179130 20:3546970-3546992 GTTAGCTCCTCATGGGTGGGAGG - Intronic
1170440851 20:16377464-16377486 GTCCCAGCCACTTGGGTGGCTGG + Intronic
1170525024 20:17228203-17228225 GTCCTCTCCTGATGCGTGGGCGG + Intronic
1173571728 20:44081528-44081550 GTCCCCTCCTCCTGTCAGGGAGG - Intergenic
1173865057 20:46308068-46308090 GCCCCCTCCTCTCGGCCGGGAGG - Intronic
1174896567 20:54455621-54455643 GTCCCAGCCACTTGGGAGGGTGG - Intergenic
1175741560 20:61423165-61423187 GTCCCATCCTCGTGGGTCTGGGG - Intronic
1176059495 20:63166192-63166214 GTTCCCTCCACATGGGAGGGTGG + Intergenic
1176524121 21:7852388-7852410 CTACCCTCCTCCAGGGTGGGGGG - Intergenic
1176556570 21:8256681-8256703 CCCCTCTCCTCTTGGGCGGGGGG + Intergenic
1176575509 21:8439723-8439745 CCCCTCTCCTCTTGGGCGGGGGG + Intergenic
1178658141 21:34482401-34482423 CTACCCTCCTCCAGGGTGGGGGG - Intergenic
1179575979 21:42308727-42308749 TCCCCCTCCTCTTGAGTTGGTGG - Intergenic
1179782004 21:43707307-43707329 CTCCCTTTTTCTTGGGTGGGGGG + Intergenic
1180850672 22:19018501-19018523 GCCCCCTCCTCTTTGGTGACAGG + Intergenic
1181424114 22:22822116-22822138 GTCACCTGCTCATGAGTGGGAGG + Intronic
1183669466 22:39264011-39264033 GCCCCTGCCTCTGGGGTGGGGGG - Intergenic
1183928800 22:41224569-41224591 GTCTGCTACTCTGGGGTGGGGGG + Intronic
1185024003 22:48397193-48397215 GCCCCCTGCGCTTGGGTGGTGGG + Intergenic
1185265310 22:49899218-49899240 GTCCCAGCATTTTGGGTGGGAGG + Intergenic
1203253559 22_KI270733v1_random:128778-128800 CCCCTCTCCTCTTGGGCGGGGGG + Intergenic
1203261614 22_KI270733v1_random:173856-173878 CCCCTCTCCTCTTGGGCGGGGGG + Intergenic
950181629 3:10917687-10917709 GTCCCCTGCTCTTGGGAGCGGGG - Intronic
950291526 3:11788401-11788423 GTCCCAGCCACTTGGGAGGGAGG - Intergenic
952310615 3:32185981-32186003 GTCCCCTCCTGATGGGGGAGTGG + Intergenic
954385578 3:50242204-50242226 GTCTCCTCCTCTGCTGTGGGTGG - Intronic
956536326 3:70280838-70280860 GTCCCTTCCTTCTGGGTGTGGGG - Intergenic
960221222 3:115110872-115110894 GTCTCAGCCTCTTGGGTAGGTGG - Intronic
960813934 3:121654132-121654154 GTCCCCTGCTCCTGGGAGGTGGG + Intronic
962013573 3:131418205-131418227 GTCCCCTGAACTTGGGTGCGAGG - Intergenic
962588207 3:136862784-136862806 CTCCCCTCCTCTCGGGCTGGAGG - Intronic
967906152 3:194501976-194501998 GTCCCAGCCACTTGGGAGGGTGG + Intergenic
968666201 4:1823575-1823597 CTCCGCTCTTCTGGGGTGGGGGG - Intronic
968891511 4:3371871-3371893 CTCCCCTCATCTTGAGGGGGAGG + Intronic
969199511 4:5591452-5591474 ATCTTCCCCTCTTGGGTGGGTGG + Intronic
969291047 4:6240227-6240249 TGCCCCTTCTCTTGGCTGGGCGG + Intergenic
969373782 4:6750035-6750057 GTCCCCTTTTCTTAGGTGAGGGG + Intergenic
969395522 4:6918097-6918119 CTCCTCTCCTCTGCGGTGGGGGG - Intronic
969613343 4:8238801-8238823 TTTCCTTCCTCCTGGGTGGGCGG - Intronic
972493162 4:39607047-39607069 GTCCCAGCCACTTGGGTGGTTGG + Intronic
975391943 4:73830310-73830332 TTCCCCACCTCTTGTGTGGATGG - Intergenic
975415453 4:74099313-74099335 GGCCCCGCCTCTGGGGTGGAGGG + Intergenic
975760585 4:77615924-77615946 GCCCCCACCTTCTGGGTGGGTGG + Intergenic
977649886 4:99457237-99457259 TTCCCCTCCTGTTGGGTGGCTGG + Intergenic
978173060 4:105697267-105697289 GTGCCCTCCTTTTGGGGGAGGGG - Intronic
985842356 5:2317768-2317790 GTCCCCCGATCTTGGGTAGGGGG + Intergenic
989978365 5:50612178-50612200 GTGCCCTATTCTGGGGTGGGGGG + Intergenic
990988907 5:61666018-61666040 AGCCCCTCCTTTTGGGTAGGCGG + Intronic
995227408 5:109716956-109716978 TTCCCCTCATCTTGGCAGGGCGG - Intronic
995533227 5:113111275-113111297 GTCCCCTCCCCATGGCTGTGTGG + Intronic
996948709 5:129099331-129099353 GTCCTCACCCCTGGGGTGGGTGG + Intronic
999246022 5:150155191-150155213 TTCCCCTGCTCTGGGGTGAGTGG - Intronic
1001245871 5:170105761-170105783 GTCCCCTCCCCGTGGGCTGGAGG + Intergenic
1001647843 5:173295430-173295452 GCCCCCTCCTTGTGGGTGGGGGG + Intergenic
1002511462 5:179721461-179721483 GTACCCTGCTCTTGGGTGCTAGG + Intronic
1003414612 6:5896801-5896823 GTCCCTTCCTCTAGGGTGGGAGG + Intergenic
1005871924 6:29980857-29980879 TTTCCTTCCTGTTGGGTGGGAGG + Intergenic
1007536525 6:42595625-42595647 GTCCCAGCCACTTGGGTTGGGGG + Intronic
1011638619 6:89399184-89399206 ATCTCCTCCTCCTGGGAGGGTGG + Intronic
1011821456 6:91257696-91257718 GTTCCTTCCTCTTGGGTATGGGG + Intergenic
1013308855 6:108874641-108874663 GTCCCCACCTCTTGGGGATGTGG - Intronic
1018758915 6:166873475-166873497 CACCCCTCCTCTTGGGAGTGGGG + Intronic
1019457486 7:1138080-1138102 GCCCCCTCCACGTGGGTGCGCGG - Exonic
1025920954 7:65912717-65912739 ATCCCCACCTGATGGGTGGGAGG - Intronic
1026748261 7:73029492-73029514 GTCCCCGCCTCCTGAGTGGCTGG - Intergenic
1026751909 7:73057637-73057659 GTCCCCGCCTCCTGAGTGGCTGG - Intergenic
1026755558 7:73085764-73085786 GTCCCCGCCTCCTGAGTGGCTGG - Intergenic
1026977660 7:74508214-74508236 GTCCCCTCCTCTTGGGTGGGTGG - Intronic
1027034463 7:74914806-74914828 GTCCCCGCCTCCTGAGTGGCTGG - Intergenic
1027091842 7:75307623-75307645 GTCCCCGCCTCCTGAGTGGCTGG + Intergenic
1027095485 7:75335590-75335612 GTCCCCGCCTCCTGAGTGGCTGG + Intergenic
1027323856 7:77032093-77032115 GTCCCCGCCTCCTGAGTGGCTGG - Intergenic
1027829135 7:83155391-83155413 GTCCCCACCTGCTGGGTTGGAGG + Exonic
1029977561 7:104849046-104849068 GTCCCAGCTACTTGGGTGGGAGG - Intronic
1032258389 7:130315087-130315109 GTCCCTTCCACTTAGGTGTGAGG + Intronic
1036271828 8:7312078-7312100 GTTCCCTTTACTTGGGTGGGGGG + Intergenic
1036362005 8:8084484-8084506 GCCCCCTCCTGTTGGGAGGAGGG + Intergenic
1037751306 8:21684173-21684195 GTGCCCTCCTCCAGGGAGGGAGG + Intergenic
1038024428 8:23576125-23576147 TTCCCCTCCTCTGGGGTGGGCGG + Intergenic
1038532758 8:28331744-28331766 GCCCACTCCACTGGGGTGGGTGG - Intronic
1040898013 8:52389085-52389107 CTCGCCTCCTCTTGGCTGTGTGG - Intronic
1040944931 8:52874320-52874342 GCTCCCTCCTCTTGGGGTGGTGG - Intergenic
1044772443 8:95650757-95650779 CTCCCCTCTTCTTGGGGAGGTGG + Intergenic
1046231025 8:111358556-111358578 GTGCCCTGCTCTTGGGGGGCAGG + Intergenic
1046379842 8:113436637-113436659 GTCCCCTCCGCTTTGGATGGAGG - Intronic
1049251647 8:141592373-141592395 GTTCCCTCGGCTTGGGTGTGTGG + Intergenic
1052537529 9:29766150-29766172 ATCCCATGCTCCTGGGTGGGTGG + Intergenic
1054821233 9:69522306-69522328 GGCCCCAACTATTGGGTGGGAGG - Intronic
1055009182 9:71544891-71544913 GTCCCAGCTACTTGGGTGGGAGG + Intergenic
1059338877 9:113586222-113586244 GGCCACTCCTCTTTGGAGGGCGG + Intronic
1060059684 9:120448035-120448057 GTCACCACCTCCTGGGTGGCAGG + Exonic
1060201151 9:121652305-121652327 CTCCCCACCTCTTGGGTGCTAGG + Intronic
1060218126 9:121750661-121750683 GTTCCCAACTATTGGGTGGGGGG - Intronic
1060658737 9:125390154-125390176 GTCCCAGCTACTTGGGTGGGAGG - Intergenic
1061803831 9:133127411-133127433 GTCACCTCCTGTTGGGCAGGTGG + Intronic
1061923200 9:133793408-133793430 GTTCCCTCCTGCGGGGTGGGTGG - Intronic
1061926581 9:133808862-133808884 GCACCCTCCTTTTGGGTAGGGGG + Intronic
1062304234 9:135893997-135894019 GTCACCTCCCGTTGGGTGGGGGG - Intronic
1062432299 9:136531619-136531641 GTGCCCTCCTGCTGGGCGGGAGG - Intronic
1203469960 Un_GL000220v1:111925-111947 CCCCTCTCCTCTTGGGCGGGGGG + Intergenic
1203477781 Un_GL000220v1:155897-155919 CCCCTCTCCTCTTGGGCGGGGGG + Intergenic
1185936491 X:4262610-4262632 ATTCCCTCCTCTTGGGTATGGGG + Intergenic
1190714366 X:53091418-53091440 GGGCCCTGCTCCTGGGTGGGAGG + Intergenic
1190825928 X:54017888-54017910 AACCCCACCTCTTGGGTGAGTGG - Intronic
1191192409 X:57680483-57680505 GTCTCAGCCTCTTGGGTGGCTGG - Intergenic
1197773545 X:130105928-130105950 ATCCCCTCAGCTTGGGTGGCAGG + Intronic
1199847359 X:151700908-151700930 GTCACCTCCTCGTAGGAGGGGGG - Exonic
1200069567 X:153521267-153521289 GGCTCCTTCTGTTGGGTGGGCGG + Intronic
1202605414 Y:26635619-26635641 TTCGCCTCATCTTGGGTGGCTGG - Intergenic